← Back
Cyclometalated Benzimidazole Osmium(II) Complexes with Antiproliferative Activity in Cancer Cells Disrupt Calcium Homeostasis.
We
present the synthesis and characterization of six new heteroleptic
osmium(II) complexes of the type [Os(C^N)(N^N) 2 ]OTf (N^N
= 2,2′-bipyridine and dipyrido[3,2- d :2′,3′- f ]quinoxaline; C^N = deprotonated methyl 1-butyl-2aryl-benzimidazolecarboxylate)
with varying substituents in the R3 position of the phenyl ring of
the cyclometalating C^N ligand. The new compounds are highly kinetically
inert and absorb a full-wavelength range of visible light. An investigation
of the antiproliferative activity of the new compounds has been performed
using a panel of human cancer and noncancerous 2D cell monolayer cultures
under dark conditions and green light irradiation. The results demonstrate
that the new Os(II) complexes are markedly more potent than conventional
cisplatin. The promising antiproliferative activity of selected Os(II)
complexes was also confirmed using 3D multicellular tumor spheroids,
which have the characteristics of solid tumors and can mimic the tumor
tissue microenvironment. The mechanism of antiproliferative action
of complexes has also been investigated and revealed that the investigated
Os(II) complexes activate the endoplasmic reticulum stress pathway
in cancer cells and disrupt calcium homeostasis.
## Introduction
Introduction Cancer is the second leading cause of
death worldwide, accounting
for nearly 10 million deaths in 2020. 1 The
discovery of the therapeutic properties of cisplatin by Rosenberg
had an enormous impact on cancer chemotherapy. 2 Since then, complexes based not only on platinum but also on other
metals have been widely developed, for instance, ruthenium or iridium
complexes. 3 , 4 Osmium is a member of the platinum group
of metals, but its complexes have been far less explored for cancer
treatment than those based on platinum or ruthenium. The well-known
toxicity of OsO 4 was partially the cause of the rejection
of the use of osmium complexes as anticancer agents. 5 However, given the clinical success of ruthenium complexes,
which entered and progressed into clinical trials, research efforts
have been directed toward investigating the therapeutic properties
of osmium complexes. 6 , 7 First, osmium-based compounds
were synthesized as analogues of prototypal ruthenium(III) complexes
(NAMI-A, RAPTA-C, and RM-175), showing better properties when changing
the metal. 8 − 10 Subsequently, the anticancer activity of half-sandwich
complexes was explored. Sadler and co-workers developed osmium(II)
complexes containing azopyridine ligands, which were active against
various cancer cell lines. 11 Other complexes
have shown high levels of cytotoxicity, similar to cisplatin or carboplatin,
and their mechanism of action is dependent on the type of structures
and oxidation states. 12 Thus, Os(IV) complexes
containing a nitride terminal ligand induce endoplasmic reticulum
(ER) stress, 13 whereas the osmium(II) complex ODC3 ( Scheme 1 A) can induce ER stress effectors. 14 In
addition, some half-sandwich osmium(II) complexes able to potentiate
the anticancer efficacy of metformin via glucose metabolism reprogramming
have been recently reported by Liang et al. 15 Scheme 1 Examples of (A) Os(II) Polypyridyl Complex as an ER Stress Inducer, 14 (B) Os(II) Panchromatic PSs for PDT, 16 and (C) Ru(II) PSs for PDT Closely Related to
This Work 17 On the other hand, the use of osmium polypyridyl complexes as cellular
imaging and photosensitizers (PSs) in photodynamic therapy (PDT) has
gained increasing attention more recently. Generally, Os(II) polypyridyl
complexes show emission quantum yield and lifetimes lower than other
transition-metal complexes, such as ruthenium, iridium, or platinum,
for their use in cellular imaging. However, they present some advantages
over complexes based on other metals: (1) they present absorption
bands over 700 nm, which is within the biological optical window for
deep tissue penetration 14 , 18 because of the reduction
of the energy gap between the ground and excited states, (2) unlike
ruthenium-based compounds, osmium d–d states are not accessible
by thermal crossover from its excited triplet state, 19 and (3) they show excellent photostability. In this way,
McFarland and co-workers developed the Os PSs TLD1829 and TLD1824 ( Scheme 1 B) containing the auxiliary π-extended 2,2′-biquinoline
ligand, which are active by red and NIR light irradiation both under
normoxic and hypoxic conditions. 16 More
recently, an osmium–peroxo complex for photoactive therapy
of hypoxic tumors has been reported by Zhang et al. 20 The Zhang group has also investigated a benzimidazole-containing
Os(II) complex as a NIR emissive lysosomal tracker, 21 while the Thomas group has looked at DNA targeting polypyridyl
Os(II) complexes as high-resolution contrast probes for TEM. 21 Herein, we present the development of
six new cyclometalated Os(II)
complexes Os1 – Os6 of the type [Os(C^N)(N^N) 2 ]OTf ( Scheme 3 ) to evaluate their therapeutic potential
for cancer treatment. The C^N ligand ( Scheme 2 ) is based on a benzimidazole backbone, which
is widely used as pharmacophore 22 , 23 and has exhibited good
(photo)biological results in ruthenium analogues as Ru1Ph- p ( Scheme 1 C). 17 Importantly, the benzimidazole
incorporates a masked carboxylic acid function to facilitate further
functionalization. We also introduced some substitutions on the aryl
group of the C^N ligand to modulate their electronic and biological
properties. 2,2′-Bipyridine (bpy) and dipyrido[3,2- d :2′,3′- f ]quinoxaline (dpq)
were chosen as N^N ancillary ligands because their implications for
bioinorganic chemistry and light-activated metal complexes. 24 We also report that the investigated Os(II)
complexes exhibit a better antiproliferative activity in several human
cancer cells than clinically used cisplatin and that they can activate
in cancer cells the ER stress pathway and disrupt Ca 2+ homeostasis. Scheme 2 Synthesis of Proligands HL1 – HL3 :
(i) NaHSO 3 in Water at 80 °C for 1 h, Followed by
Addition of Diamine A in EtOH and Heated Overnight at
90 °C; (ii) Corresponding Phenylboronic Acid, Pd(PPh 3 ) 4 , and K 2 CO 3 in Toluene/H 2 O 2:1 and Stirred in a Microwave at 120 °C for 1 h
## Results and Discussion
Results and Discussion Synthesis and Characterization
of Proligands and Osmium(II)
Complexes The key intermediate diamine A was
efficiently obtained from 4-chloro-3-nitrobenzoic acid using reported
procedures ( Scheme S1 ). 25 The preparation of HL1 and 2-(3-bromophenyl)-benzimidazole
derivative B ( Scheme 2 ) was achieved by condensing intermediate diamine A with benzaldehyde or 3-bromobenzaldehyde, respectively,
in ethanol, using sodium bisulfite. The synthesized bromo benzimidazole
derivative B and the corresponding commercial boronic
acid reacted via a Suzuki reaction ( Scheme 1 ) to yield the new pro-ligands HL2 and HL3 with a 50–60% yield; NMR spectra showed
that the ligands were pure enough for further reactions ( Figures S2–S5 ). The polypyridyl N^N ligand
dpq was synthesized following previously reported procedures ( Scheme S2 ). 26 , 27 Dark-violet
air-stable solid osmium complexes Os1 – Os6 ( Scheme 3 ) were obtained via a two-step synthesis following
an optimized procedure with respect to the previously reported ruthenium
analogues 17 by reducing the time reaction
from 3 days to 1.5 h. First, the cyclometalation reaction was carried
out between the dimeric precursor [{Os(η 6 - p -cymene)Cl(μ-Cl)} 2 ] and the corresponding
pro-ligand HC^N, in the presence of an excess of potassium triflate
and potassium acetate, in acetonitrile at 80 °C for 1 h. Then,
the final Os(II) complex in 20–25% yield was obtained by the
reaction of the corresponding non-isolated cyclometalated intermediate
[Os(η 6 - p -cymene)(C^N)(CH 3 CN)] + 28 and the corresponding
N^N ligand (bpy or dpq) in methanol at 65 °C for 30 min ( Scheme 3 ; see the Experimental Section for further details). Scheme 3 Synthesis
of Osmium Complexes Os1 – Os6 Investigated
in This Work All complexes were
purified by alumina column chromatography DCM/CH 3 CN 1:1
and fully characterized by 1 H and 13 C or DEPT
NMR spectroscopy and mass spectrometry ( Figures S6–S17 ). The positive-ion ESI-MS spectra displayed
the [M – CF 3 SO 3 ] + peaks ( Table S1 ) with the expected isotopic distribution
pattern. The 1 H NMR spectra in CD 3 CN show the
presence of many resonances with some overlapping features within
the range of 6.0–9.5 ppm for the aromatic hydrogens and the
aliphatic peaks from the benzimidazole-based ligands. Complexes were
shown to be at least 96% pure by elemental analysis of C, H, N, and
S. It is noteworthy that the 1 H NMR spectra of cyclometalated
complexes Os3 – Os6 (at 1 mM) showed
( Figures S18–S20 ) significant differences
at different compositions of mixtures of DMSO- d 6 and D 2 O. Thus, an upfield shift in some aromatic
resonances of the ligands is observed. In addition, an increase in
the water content up to 50–70% gives broad signals that lead
to the virtual disappearance of the resonances in their 1 H NMR spectra, with no precipitation being observed in the conditions
used (see Figures S19 and S20 for Os4 – Os6 ), suggesting their self-assembly
into supramolecular aggregates. A similar observation was previously
found for Ru1Ph- p ( Scheme 1 C) and other related cycloruthenated
complexes. 17 , 29 Crystals suitable for X-ray
crystallography were obtained by slow
diffusion of diethyl ether into a solution of complex Os3 in dichloromethane. Figure 1 a shows the crystal structure of the cation of Os3 elucidated by single-crystal X-ray analysis. Apart from the cation–anion
triflate Coulombic interaction, the packing in the structure of Os3 is organized by C–H···F and C–H···O
intermolecular interactions ( Table S4 and Figure 1 b). Crystallographic
data are listed in Table S3 . The complex
presents an octahedral geometry around the osmium ion with the four
nitrogen atoms of the two bpy ligands (N1–N4) and the remaining
positions occupied by the C^N ligand. The nitrogen atom of the C^N
ligand (N5) is in trans position to the nitrogen
N3 of one bpy ligand. The carbon atom of the C^N ligand (C15) is trans to the nitrogen N2 of the other bpy. The Os–N bpy bond distances (2.0334–2.1210 Å) are within
the range reported for osmium complexes. 14 The bond distance Os–C15 2.048(2) Å lies in the range
reported for osmium compounds containing cyclometalated ligands, 14 and the trans influence of
the C atom σ-bound to the metal is reflected in longer Os–N2
distance 2.1210(18) Å. Figure 1 X-ray crystal structure of Os3 (a)
and C–H···O
intermolecular interactions (b). Ellipsoids are drawn in (a) at the
50% probability level. Hydrogen atoms, counterions, and solvent molecules
are omitted for clarity. Selected bond lengths [Å] and angles
[°] for Os3 : Os(01)–N(1) = 2.0495(19), Os(01)–N(2)
= 2.1210(18), Os(01)–N(3) = 2.0334(18), Os(01)–N(4)
= 2.040(2), Os(01)–N(5) = 2.0727(18), Os(01)–C(15) =
2.048(2), N(1)–Os(01)–N(2) = 77.01(7), N(3)–Os(01)–N(4)
= 78.23(7), and C(15)–Os(01)–N(5) = 77.46(8). The UV–vis absorption spectra of the new
osmium complexes
were recorded in acetonitrile at room temperature ( Figure 2 and Table S2 ). The new compounds are panchromatic absorbers as they exhibit
continuous absorption from 200 to 900 nm, including the NIR-infrared
region, which is desirable for PDT. They present strong absorbance
between 200 and 400 nm (ε ∼ 120 000–60 000 M –1 cm –1 ) due to π–π*
electronic transitions of the C^N and N^N ligands. The moderately
intense absorption bands in the visible range, between 370 and 630
nm, could be assigned to spin-allowed metal-to-ligand charge transfer
(MLCT), whereas the weak and broad spin-forbidden 3 MLCT
absorption bands were seen in the NIR region transitions owing to
strong spin–orbit coupling due to the heavy atom effect of
osmium (630–900 nm). 21 , 30 As observed, subtle
structural modifications of the C^N ligand only had a moderate effect
on the UV–vis absorption spectra of the corresponding Os complexes. Figure 2 UV–vis
absorption spectra of Os1–Os2 (top) and Os3–Os6 (bottom) in acetonitrile at
room temperature. The inset shows an expansion of the 450–1000
nm region. The absorption spectra of complexes Os1 , Os2 , Os4 , and Os6 (at 10 μM) in the
Roswell Park Memorial Institute medium (RPMI) at 37 °C [a mixture
95:5 (RPMI/DMSO) presented no significant changes over 48 h, as shown
in Figure S22 ], suggesting that they were
stable in this growth medium used to grow a variety of mammalian cell
types. On the other hand, the UV–vis spectra for Os3 and Os5 in the same conditions suggested aggregation
and/or slow precipitation, with neither obvious reaction nor isosbestic
point being observed. So more diluted conditions (at 1 μM) were
used for running their UV–vis spectra ( Figure S22 ). On the other hand, the new complexes exhibited
no photodegradation
under white light irradiation (51 mW/cm 2 ) during 1.5 h
in air-saturated DMSO solution (10 μM), as shown by UV–vis
spectroscopy, and their absorption spectra ( Figure S23 ) remain the same before and after light exposure. The capacity
of Os1–Os6 to generate 1 O 2 upon irradiation at 520 nm in aerated CH 3 CN was examined
by measuring the absorption of 1,3-diphenylisobenzofuran (DPBF) at
413 nm in acetonitrile solution, although extremely low Φ 1 O 2 (Φ Δ ) was observed (<0.033; Figures S24–S26, Table S5 ). Important
to note, the analogue ruthenium complex Ru1Ph- p ( Scheme 1 C)
exhibited much higher quantum yield of singlet oxygen (0.20 in CH 3 CN under green light irradiation) 17 than the osmium complexes herein reported. Probably the lifetimes
of the triplet excited states of these new osmium compounds are shorter
because deactivation through nonradiative mechanisms could be operating
at higher rates for them. Cell Viability The activity of Os1 – Os6 against a panel of human cancer
cell lines was assessed
by the commonly used 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) assay. The IC 50 values derived from concentration–response
curves are summarized in Table 1 and compared with those found for clinically used cisplatin.
All the osmium complexes [Os(C^N)(N^N) 2 ]OTf display very
low (mostly submicromolar or, rarely, low micromolar) IC 50 values, which are markedly lower than those yielded by cisplatin.
Complex Os3 , which contains bipyridine as the N^N ligand,
was the most potent, whereas complex Os6 , which contains
the dpq as the N^N ligand, was the least active all over the tested
cell lines but still markedly more potent than cisplatin. We also
conducted viability studies with healthy lung fibroblast MRC5pd30
and normal adult prostatic epithelial cells PNT1A. In general, all
osmium complexes were at least as potent toward noncancerous as against
cancerous cells. Table 1 IC 50 Values [μM]
of Osmium Complexes Os1 – Os6 in a
Panel of Human Cell Lines Determined by MTT after 72 h Incubation
in the Dark a Os1 Os2 Os3 Os4 Os5 Os6 cisplatin PSN1 0.37 ± 0.05 0.45 ± 0.06 0.24 ± 0.03 0.53 ± 0.04 0.57 ± 0.08 1.4 ± 0.1 3.2 ± 0.1 MCF7 0.23 ± 0.03 0.13 ± 0.02 0.15 ± 0.04 0.24 ± 0.01 0.32 ± 0.07 0.92 ± 0.06 14 ± 2 HeLa 0.9 ± 0.1 0.8 ± 0.1 0.6 ± 0.1 0.63 ± 0.06 0.7 ± 0.1 1.1 ± 0.1 14 ± 2 HCT116 0.3 ± 0.1 0.17 ± 0.04 0.12 ± 0.03 0.46 ± 0.08 0.31 ± 0.03 0.71 ± 0.05 9 ± 2 MDA-MB-231 0.26 ± 0.04 0.19 ± 0.03 0.08 ± 0.02 0.28 ± 0.03 0.31± 0.03 0.96 ± 0.04 21 ± 2 OE33 0.31 ± 0.08 0.15 ± 0.03 0.23 ± 0.01 0.45 ± 0.02 0.60 ± 0.06 1.94 ± 0.05 7 ± 1 A375 0.43 ± 0.03 0.27 ± 0.04 0.20 ± 0.02 0.46 ± 0.04 0.55 ± 0.07 1.5 ± 0.2 3.0 ± 0.9 MRC5pd30 0.46 ± 0.05 0.21 ± 0.03 0.19 ± 0.01 0.22 ± 0.02 0.47 ± 0.02 0.7 ± 0.2 12 ± 1 PNT1A 0.19 ± 0.02 0.08 ± 0.01 0.13 ± 0.03 0.40 ± 0.02 0.31 ± 0.01 0.57 ± 0.02 2.4 ± 0.2 a Data represent
a mean ± SD
from at least three independent experiments, each performed in triplicate. The data of the MTT test revealed
that Os complexes effectively
reduce the viability of cells. The MTT assay is based on assaying
ongoing cellular (mitochondrial) metabolism, i.e., factors that reflect
the number of living cells in the sample. Like that, the MTT assay
could not distinguish the effects on cell death (cytotoxicity) on
the one hand and cell growth inhibition (cytostatic effect) on the
other hand. Therefore, a trypan blue exclusion assay was employed
to reveal whether Os complexes inhibit cell proliferation or directly
kill the cells. This assay allows cytotoxicity assessment by the direct
measurement of the number of dead or damaged cells in a population.
The most sensitive MDA-MB-231 cells ( Table 1 ) were treated with Os3 or Os6 (the representatives of the family with the highest and
the lowest activity), and cells were harvested at certain incubation
intervals, stained by trypan blue, and counted. A short incubation
time (8 h) was also included to uncover possible acute toxicity. As indicated in Figure 3 , the complexes efficiently inhibited cell division and, therefore,
the growth of the cell population. However, they show no significant
toxic effect in MDA-MB-231 cells ( Figure S27 ). Furthermore, even after a long incubation time (96 h), the number
of dead cells was relatively low (ca. 10–20%, Figure S27 ). Thus, this experiment revealed that Os complexes
are not toxic but rather strongly antiproliferative. Figure 3 Growth profile of MDA-MB-231
cells untreated or treated with Os3 or Os6 . The cells were treated (at t = 0) with the equitoxic
concentrations of compounds corresponding
to IC 50,72h or 3 × IC 50,72h , as determined
by MTT ( Table 1 ). Although the cells were not dead yet with a compromised
cell membrane
in the time scale of the experiment, their morphology was significantly
affected by the treatment with Os3 or Os6 , as indicated in Figure 4 . This revealed physiological changes in MDA-MB-231 cells
caused by Os3 and Os6 , especially at longer
times and/or higher concentrations. Thus, not only was cell growth
inhibited but the cells also showed significant changes in their morphology.
Changes in the cell structure are thought to be due to the rearrangement
of cytoskeletal proteins and are critically involved in the transformation
of adhesion and polarized cell migration required for the success
of the metastatic process. 31 − 33 Figure 4 Phase-contrast images of MDA-MB-231 taken
at 24, 48, and 72 h of
incubation with Os3 or Os6 at indicated
concentrations. Untreated MDA-MB-231 cells (C) showed an elongated
and spindle-shaped morphology with large protruding lamellipodia.
After treatment, cells become round-shaped with shorter lamellipodia
(the representative cells of this morphology are indicated by arrows).
For better resolution, the bottom two panels show a magnified section
of the image of untreated cells (C) and cells after treatment with Os3 (1 × IC 50 ), both at 72 h. In all images,
the scale bar represents 50 μm. Antiproliferative Effect of Os Complexes in Three-Dimensional
(3D) Cell Culture Although cell cultures grown in 2D monolayer
are the most frequently used for testing the biological activity of
various metallodrugs, three-dimensional (3D) cell cultures are assumed
to be a more representative model for in vitro anticancer drug screening. 34 , 35 Cells growing in 3D cultures possess several features of “in
vivo” tumors, such as hypoxia, cell–cell interaction,
drug penetration, and production/deposition of the extracellular matrix. 36 , 37 Therefore, the effect of the two selected complexes, Os3 and Os6 , was also tested on 3D cultures of MDA-MB-231
cells to provide more relevant data on its antitumor activity ( Figures 5 and S28 ). Figure 5 Representative images of MDA-MB-231 spheroids
untreated (A) or
treated with complex Os3 at concentration 0.62 (B), 1.25
(C), 2.5 μM (D), complex Os6 at 2.5 μM (E),
and cisplatin at 50 μM (F). The concentrations used in panels
(B,E) roughly correspond to the IC 50 values found for Os3 and Os6 , respectively. Scale bars represent
100 μm. MDA-MB-231 mammospheres were markedly
more sensitive to the investigated
osmium complexes than to conventional cisplatin, and complex Os3 containing the electron-donating substituent NMe 2 was significantly more potent compared to Os6 ( Figure 5 and Table 2 ). These results confirm the
trend in antiproliferative activity found for 2D monolayer MDA-MB-231
cells ( Table 1 ); however,
the difference between the antiproliferative activities of the two
complexes is less pronounced. This may reflect properties typical
for 3D but not for 2D cultures, such as different penetration to the
cells inside 3D spheroids. Table 2 IC 50 Values a (μM) Obtained for the Investigated Os Compounds
in
MDA-MB-231 Derived Mammospheres Determined Using CellTiter-Glo 3D
Cell Viability Assay IC 50 (μM) Os3 0.82 ± 0.05 Os6 2.2 ± 0.1 cisplatin 59 ± 6 a Data represent
mean values ±
SD from three independent experiments. Determination of Intracellular Reactive Oxygen Species In general, the redox activity of Os(II) complexes is associated
with the formation of reactive oxygen species (ROS) in cells. 12 In this context, many previously reported osmium
compounds had been shown to induce oxidative stress in cancer cells. 38 − 42 To assess the causative role of oxidative stress in the biological
effects of the complexes tested in this study, the generation of ROS
by complexes Os3 and Os6 was investigated
by the CellROX green assay. Although menadiol (a positive control)
was significantly active in this experiment, levels of ROS in MDA-MB-231
cells indicated upon exposure to a wide range of drug concentrations
were not elevated for both Os complexes ( Figure S29 ). This suggests that increased ROS production was unlikely
to play a role in the biological activity of these Os(II) benzimidazole
complexes. Effect on Calcium Homeostasis Based
on the abovementioned
results, oxidative stress due to ROS formation was ruled out as a
possible mechanism of action. Thus, the biological effects must therefore
be related to another mechanism. A number of previously reported osmium
(and ruthenium) compounds are assumed to induce cell death through
activation of the ER stress pathway. 14 , 43 − 45 These findings led us to investigate the possibility that Os(II)
benzimidazole complexes may induce ER stress as well. The ER
is a cellular organelle crucial for peptide synthesis and maturation,
lipid synthesis, detoxification of chemicals, and, importantly, calcium
(Ca 2+ ) storage. 46 An elevated
endoplasmic Ca 2+ level relative to the cytosol is of critical
importance for cells because of its role in regulating a variety of
cellular processes. Frequently, ER stress leads to the release of
Ca 2+ from the ER lumen; 47 therefore,
the changes in Ca 2+ levels are considered a reliable marker
for ER stress. 48 Calcium release
from ER into the cytoplasm was studied using the
calcium-sensitive fluorescent probe Fluo-4 AM. As indicated in Figure 5 , incubation with
the investigated Os complexes resulted in a significant elevation
of cytoplasmic Ca 2+ concentration even after a short incubation
time; the effect was both concentration ( Figure 6 A,B) and time ( Figure 6 C) dependent. Interestingly, Os3 was roughly 10-fold more effective than Os6 ( Figure 6 C), reflecting their
antiproliferative potency (IC 50 values differ by ca. 10-fold, Table 1 ). This suggests that
the antiproliferative effects of the Os complexes tested in this work
may be closely related to the loss of Ca 2+ homeostasis
and disruption of Ca 2+ signaling. Figure 6 Cytoplasmic calcium level
in MDA-MB-231 cells determined by the
Fluo-4 reagent. MDA-MB-231 cells were treated with indicated concentrations
of Os complexes. Cytoplasmic calcium level was measured immediately
after the treatment. (A,B) Cells were treated with various concentrations
of Os3 or Os6 for 2 (A) or 24 h (B) in the
dark. (C) Comparison of the values obtained for equipotent concentrations
of Os3 and Os6 . The values represent the
fluorescence intensity (median) related to the value found for control,
untreated cells. However, the treatment-associated
elevation of cytoplasmic Ca 2+ may depend on interference
with calcium homeostasis systems
other than ER. Therefore, to further support the view that Os(II)
benzimidazole belongs to the ER stress inductors, we analyzed the
expression of key biomarkers of the ER stress pathway. 13 Using qRT-PCR, we found that the expression
of several biomarkers of this pathway was significantly affected by
Os complexes, such as Bip, Ero1-Lα, IRE1α, and CHOP ( Figures 7 and S30 ), so that the level of particular mRNAs was
2.5–4.9 above the level found in untreated cells. The effect
was dependent on incubation time and was very similar for both, Os3 and Os6 when applied in equitoxic concentrations
( Figure S30 ). Figure 7 qRT-PCR of the ER stress
markers in MDA-MB-231 cells treated with
the tested Os3 complex. Cells were treated for 24 h at
the concentration corresponding to 3 × IC 50,72h . Relative
quantification of gene expression was calculated using the 2 –ΔΔ Ct method. The GAPDH gene was used as the endogenous
reference control, and samples isolated from the untreated cells were
used as the arbitrary calibrators. Data were subjected to statistical
analysis using Student’s t test and a significant
difference (* p ≤ 0.01) from untreated control
samples (dashed line). To confirm that the changes
in mRNA levels are translated into
the proteins, Western blotting analysis was performed. The results
clearly confirm the significantly increased expression of selected
ER markers ( Figure 8 ). The effect was both concentration- and time-dependent ( Figures 8 and S31 ). The quantitative analyses of the latter
results revealed that particularly Ire1α and CHOP were increased
dramatically; the protein levels in cells treated for 24 h with equitoxic
concentrations (3 × IC 50 ) of Os 3 or Os6 were increased ca. 15–20 times (Ire1α) or
even 130 times (CHOP), as compared to untreated cells. Hence, the
intensity of the induction suggested that the investigated Os complexes
are efficient inducers of at least some markers of ER stress, which
might be biologically relevant. Figure 8 (A) Western blot images of ER stress markers
and GAPDH in MDA-MB-231
cells non-treated (C) or treated with Os3 at 0.5, 1,
or 5 μM concentrations for 4, 14, or 24 h. (B) Western blot
images of ER stress markers and GAPDH in MDA-MB-231 cells non-treated
(C) or treated with Os3 or Os6 at their
equitoxic concentrations corresponding to 3 × IC 50,72h for 4, 14, and 24 h. For quantitative evaluation, see Figure S31 . Phototoxicity Testing The photoactivatibility of the
complexes has been tested on three different human cancer cell lines,
namely, cervical adenocarcinoma HeLa, esophageal carcinoma OE33, and
melanoma A375 cells. These lines were chosen because these types of
tumor tissues are readily available for PDT treatment. The phototoxicity
data are summarized in Table 3 . As indicated, the antiproliferative activity of all investigated
complexes was promoted by irradiation with green light under normoxic
conditions. Among the tested compounds, Os1 was the most
sensitive to irradiation, demonstrating the highest phototoxicity
index (∼4) in all cell lines. As the complexes in the dark
do not show significant selectivity for tumor versus noncancerous
cells ( Table 1 ), their
photopotentiation may represent a considerable advantage. During photodynamic
chemotherapy, only tumor tissue is irradiated selectively so that
the photopotentiation at the site of the tumor can significantly increase
the difference between the effects on cancer and healthy (nonirradiated)
tissue. Table 3 IC 50 Values a (μM) Obtained for HeLa, OE33, and A375 Cancer Cells
Treated with the Investigated Os Complexes in the Dark or after Irradiation
by Green Light (1 h, λ max = 533 nm, 77 ± 3 W
m –2 ) Determined by the MTT Assay HeLa (normoxia) HeLa (hypoxia) OE33 (normoxia) A375 (normoxia) dark irrad PI dark irrad PI dark irrad PI dark irrad PI Os1 2.6 ± 0.4 0.6 ± 0.1 4.3 3.0 ± 0.4 1.5± 0.4 2.0 0.9 ± 0.1 0.21 ± 0.06 4.3 0.8 ± 0.1 0.19 ± 0.02 4.2 Os2 0.8 ± 0.2 0.31 ± 0.04 2.6 0.7 ± 0.1 0.6± 0.1 1.2 0.50 ± 0.08 0.19 ± 0.03 2.6 0.4 ± 0.1 0.19 ± 0.05 2.1 Os3 2.0 ± 0.3 0.9 ± 0.3 2.2 3.6 ± 0.5 2.2 ± 0.2 1.6 1.5 ± 0.4 0.9 ± 0.2 1.7 0.8 ± 0.2 0.44 ± 0.08 1.8 Os4 1.0 ± 0.3 0.5 ± 0.1 2.0 0.5 ± 0.1 0.41 ± 0.04 1.2 6 ± 1 3.3 ± 0.3 1.8 0.9 ± 0.2 0.5 ± 0.1 1.8 Os5 4.2 ± 0.8 1.6 ± 0.4 2.6 3.4 ± 0.6 2.4 ± 0.4 1.4 4 ± 1 2.0 ± 0.6 2.0 0.8 ± 0.2 0.6 ± 0.1 1.3 Os6 2.0 ± 0.6 1.5 ± 0.5 1.3 1.3 ± 0.4 1.1 ± 0.2 1.2 6 ± 1 5 ± 1 1.2 1.4 ± 0.1 1.4 ± 0.3 1.0 a Cells were treated with Os compounds
for 1 h in the dark followed by 1 h irradiation (or shame irradiation).
The assay was evaluated after 70 h post-incubation in a drug-free
medium. Normoxia (21% O 2, 5% CO 2 ), hypoxia (3%
O 2, 5% CO 2 ), PI (phototoxic index) = [IC 50 ] dark /[IC 50 ] irrad. The results
are expressed as mean values ± SD from at least three independent
experiments, each made in triplicate. The antiproliferative activity of Os(II) complexes
was also determined
under hypoxic conditions (3% O 2 ) in the model HeLa cells.
All investigated Os compounds showed significant activities even in
hypoxia ( Table 3 ),
both in the dark and after irradiation. Irradiation also led to a
photopotentiation in these hypoxic conditions, although the PI was
slightly lower for most complexes than that determined under a normal
oxygen concentration. In the case of Os4 , Os5 , and Os6 , the antiproliferative activity determined
after irradiation under hypoxic conditions was even similar to that
determined under normoxic conditions. The results thus suggest that
the investigated Os complexes might represent candidate compounds
for the therapeutic treatment of hypoxic tumors.
## Synthesis and Characterization
of Proligands and Osmium(II)
Complexes
Synthesis and Characterization
of Proligands and Osmium(II)
Complexes The key intermediate diamine A was
efficiently obtained from 4-chloro-3-nitrobenzoic acid using reported
procedures ( Scheme S1 ). 25 The preparation of HL1 and 2-(3-bromophenyl)-benzimidazole
derivative B ( Scheme 2 ) was achieved by condensing intermediate diamine A with benzaldehyde or 3-bromobenzaldehyde, respectively,
in ethanol, using sodium bisulfite. The synthesized bromo benzimidazole
derivative B and the corresponding commercial boronic
acid reacted via a Suzuki reaction ( Scheme 1 ) to yield the new pro-ligands HL2 and HL3 with a 50–60% yield; NMR spectra showed
that the ligands were pure enough for further reactions ( Figures S2–S5 ). The polypyridyl N^N ligand
dpq was synthesized following previously reported procedures ( Scheme S2 ). 26 , 27 Dark-violet
air-stable solid osmium complexes Os1 – Os6 ( Scheme 3 ) were obtained via a two-step synthesis following
an optimized procedure with respect to the previously reported ruthenium
analogues 17 by reducing the time reaction
from 3 days to 1.5 h. First, the cyclometalation reaction was carried
out between the dimeric precursor [{Os(η 6 - p -cymene)Cl(μ-Cl)} 2 ] and the corresponding
pro-ligand HC^N, in the presence of an excess of potassium triflate
and potassium acetate, in acetonitrile at 80 °C for 1 h. Then,
the final Os(II) complex in 20–25% yield was obtained by the
reaction of the corresponding non-isolated cyclometalated intermediate
[Os(η 6 - p -cymene)(C^N)(CH 3 CN)] + 28 and the corresponding
N^N ligand (bpy or dpq) in methanol at 65 °C for 30 min ( Scheme 3 ; see the Experimental Section for further details). Scheme 3 Synthesis
of Osmium Complexes Os1 – Os6 Investigated
in This Work All complexes were
purified by alumina column chromatography DCM/CH 3 CN 1:1
and fully characterized by 1 H and 13 C or DEPT
NMR spectroscopy and mass spectrometry ( Figures S6–S17 ). The positive-ion ESI-MS spectra displayed
the [M – CF 3 SO 3 ] + peaks ( Table S1 ) with the expected isotopic distribution
pattern. The 1 H NMR spectra in CD 3 CN show the
presence of many resonances with some overlapping features within
the range of 6.0–9.5 ppm for the aromatic hydrogens and the
aliphatic peaks from the benzimidazole-based ligands. Complexes were
shown to be at least 96% pure by elemental analysis of C, H, N, and
S. It is noteworthy that the 1 H NMR spectra of cyclometalated
complexes Os3 – Os6 (at 1 mM) showed
( Figures S18–S20 ) significant differences
at different compositions of mixtures of DMSO- d 6 and D 2 O. Thus, an upfield shift in some aromatic
resonances of the ligands is observed. In addition, an increase in
the water content up to 50–70% gives broad signals that lead
to the virtual disappearance of the resonances in their 1 H NMR spectra, with no precipitation being observed in the conditions
used (see Figures S19 and S20 for Os4 – Os6 ), suggesting their self-assembly
into supramolecular aggregates. A similar observation was previously
found for Ru1Ph- p ( Scheme 1 C) and other related cycloruthenated
complexes. 17 , 29 Crystals suitable for X-ray
crystallography were obtained by slow
diffusion of diethyl ether into a solution of complex Os3 in dichloromethane. Figure 1 a shows the crystal structure of the cation of Os3 elucidated by single-crystal X-ray analysis. Apart from the cation–anion
triflate Coulombic interaction, the packing in the structure of Os3 is organized by C–H···F and C–H···O
intermolecular interactions ( Table S4 and Figure 1 b). Crystallographic
data are listed in Table S3 . The complex
presents an octahedral geometry around the osmium ion with the four
nitrogen atoms of the two bpy ligands (N1–N4) and the remaining
positions occupied by the C^N ligand. The nitrogen atom of the C^N
ligand (N5) is in trans position to the nitrogen
N3 of one bpy ligand. The carbon atom of the C^N ligand (C15) is trans to the nitrogen N2 of the other bpy. The Os–N bpy bond distances (2.0334–2.1210 Å) are within
the range reported for osmium complexes. 14 The bond distance Os–C15 2.048(2) Å lies in the range
reported for osmium compounds containing cyclometalated ligands, 14 and the trans influence of
the C atom σ-bound to the metal is reflected in longer Os–N2
distance 2.1210(18) Å. Figure 1 X-ray crystal structure of Os3 (a)
and C–H···O
intermolecular interactions (b). Ellipsoids are drawn in (a) at the
50% probability level. Hydrogen atoms, counterions, and solvent molecules
are omitted for clarity. Selected bond lengths [Å] and angles
[°] for Os3 : Os(01)–N(1) = 2.0495(19), Os(01)–N(2)
= 2.1210(18), Os(01)–N(3) = 2.0334(18), Os(01)–N(4)
= 2.040(2), Os(01)–N(5) = 2.0727(18), Os(01)–C(15) =
2.048(2), N(1)–Os(01)–N(2) = 77.01(7), N(3)–Os(01)–N(4)
= 78.23(7), and C(15)–Os(01)–N(5) = 77.46(8). The UV–vis absorption spectra of the new
osmium complexes
were recorded in acetonitrile at room temperature ( Figure 2 and Table S2 ). The new compounds are panchromatic absorbers as they exhibit
continuous absorption from 200 to 900 nm, including the NIR-infrared
region, which is desirable for PDT. They present strong absorbance
between 200 and 400 nm (ε ∼ 120 000–60 000 M –1 cm –1 ) due to π–π*
electronic transitions of the C^N and N^N ligands. The moderately
intense absorption bands in the visible range, between 370 and 630
nm, could be assigned to spin-allowed metal-to-ligand charge transfer
(MLCT), whereas the weak and broad spin-forbidden 3 MLCT
absorption bands were seen in the NIR region transitions owing to
strong spin–orbit coupling due to the heavy atom effect of
osmium (630–900 nm). 21 , 30 As observed, subtle
structural modifications of the C^N ligand only had a moderate effect
on the UV–vis absorption spectra of the corresponding Os complexes. Figure 2 UV–vis
absorption spectra of Os1–Os2 (top) and Os3–Os6 (bottom) in acetonitrile at
room temperature. The inset shows an expansion of the 450–1000
nm region. The absorption spectra of complexes Os1 , Os2 , Os4 , and Os6 (at 10 μM) in the
Roswell Park Memorial Institute medium (RPMI) at 37 °C [a mixture
95:5 (RPMI/DMSO) presented no significant changes over 48 h, as shown
in Figure S22 ], suggesting that they were
stable in this growth medium used to grow a variety of mammalian cell
types. On the other hand, the UV–vis spectra for Os3 and Os5 in the same conditions suggested aggregation
and/or slow precipitation, with neither obvious reaction nor isosbestic
point being observed. So more diluted conditions (at 1 μM) were
used for running their UV–vis spectra ( Figure S22 ). On the other hand, the new complexes exhibited
no photodegradation
under white light irradiation (51 mW/cm 2 ) during 1.5 h
in air-saturated DMSO solution (10 μM), as shown by UV–vis
spectroscopy, and their absorption spectra ( Figure S23 ) remain the same before and after light exposure. The capacity
of Os1–Os6 to generate 1 O 2 upon irradiation at 520 nm in aerated CH 3 CN was examined
by measuring the absorption of 1,3-diphenylisobenzofuran (DPBF) at
413 nm in acetonitrile solution, although extremely low Φ 1 O 2 (Φ Δ ) was observed (<0.033; Figures S24–S26, Table S5 ). Important
to note, the analogue ruthenium complex Ru1Ph- p ( Scheme 1 C)
exhibited much higher quantum yield of singlet oxygen (0.20 in CH 3 CN under green light irradiation) 17 than the osmium complexes herein reported. Probably the lifetimes
of the triplet excited states of these new osmium compounds are shorter
because deactivation through nonradiative mechanisms could be operating
at higher rates for them.
## Cell Viability
Cell Viability The activity of Os1 – Os6 against a panel of human cancer
cell lines was assessed
by the commonly used 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) assay. The IC 50 values derived from concentration–response
curves are summarized in Table 1 and compared with those found for clinically used cisplatin.
All the osmium complexes [Os(C^N)(N^N) 2 ]OTf display very
low (mostly submicromolar or, rarely, low micromolar) IC 50 values, which are markedly lower than those yielded by cisplatin.
Complex Os3 , which contains bipyridine as the N^N ligand,
was the most potent, whereas complex Os6 , which contains
the dpq as the N^N ligand, was the least active all over the tested
cell lines but still markedly more potent than cisplatin. We also
conducted viability studies with healthy lung fibroblast MRC5pd30
and normal adult prostatic epithelial cells PNT1A. In general, all
osmium complexes were at least as potent toward noncancerous as against
cancerous cells. Table 1 IC 50 Values [μM]
of Osmium Complexes Os1 – Os6 in a
Panel of Human Cell Lines Determined by MTT after 72 h Incubation
in the Dark a Os1 Os2 Os3 Os4 Os5 Os6 cisplatin PSN1 0.37 ± 0.05 0.45 ± 0.06 0.24 ± 0.03 0.53 ± 0.04 0.57 ± 0.08 1.4 ± 0.1 3.2 ± 0.1 MCF7 0.23 ± 0.03 0.13 ± 0.02 0.15 ± 0.04 0.24 ± 0.01 0.32 ± 0.07 0.92 ± 0.06 14 ± 2 HeLa 0.9 ± 0.1 0.8 ± 0.1 0.6 ± 0.1 0.63 ± 0.06 0.7 ± 0.1 1.1 ± 0.1 14 ± 2 HCT116 0.3 ± 0.1 0.17 ± 0.04 0.12 ± 0.03 0.46 ± 0.08 0.31 ± 0.03 0.71 ± 0.05 9 ± 2 MDA-MB-231 0.26 ± 0.04 0.19 ± 0.03 0.08 ± 0.02 0.28 ± 0.03 0.31± 0.03 0.96 ± 0.04 21 ± 2 OE33 0.31 ± 0.08 0.15 ± 0.03 0.23 ± 0.01 0.45 ± 0.02 0.60 ± 0.06 1.94 ± 0.05 7 ± 1 A375 0.43 ± 0.03 0.27 ± 0.04 0.20 ± 0.02 0.46 ± 0.04 0.55 ± 0.07 1.5 ± 0.2 3.0 ± 0.9 MRC5pd30 0.46 ± 0.05 0.21 ± 0.03 0.19 ± 0.01 0.22 ± 0.02 0.47 ± 0.02 0.7 ± 0.2 12 ± 1 PNT1A 0.19 ± 0.02 0.08 ± 0.01 0.13 ± 0.03 0.40 ± 0.02 0.31 ± 0.01 0.57 ± 0.02 2.4 ± 0.2 a Data represent
a mean ± SD
from at least three independent experiments, each performed in triplicate. The data of the MTT test revealed
that Os complexes effectively
reduce the viability of cells. The MTT assay is based on assaying
ongoing cellular (mitochondrial) metabolism, i.e., factors that reflect
the number of living cells in the sample. Like that, the MTT assay
could not distinguish the effects on cell death (cytotoxicity) on
the one hand and cell growth inhibition (cytostatic effect) on the
other hand. Therefore, a trypan blue exclusion assay was employed
to reveal whether Os complexes inhibit cell proliferation or directly
kill the cells. This assay allows cytotoxicity assessment by the direct
measurement of the number of dead or damaged cells in a population.
The most sensitive MDA-MB-231 cells ( Table 1 ) were treated with Os3 or Os6 (the representatives of the family with the highest and
the lowest activity), and cells were harvested at certain incubation
intervals, stained by trypan blue, and counted. A short incubation
time (8 h) was also included to uncover possible acute toxicity. As indicated in Figure 3 , the complexes efficiently inhibited cell division and, therefore,
the growth of the cell population. However, they show no significant
toxic effect in MDA-MB-231 cells ( Figure S27 ). Furthermore, even after a long incubation time (96 h), the number
of dead cells was relatively low (ca. 10–20%, Figure S27 ). Thus, this experiment revealed that Os complexes
are not toxic but rather strongly antiproliferative. Figure 3 Growth profile of MDA-MB-231
cells untreated or treated with Os3 or Os6 . The cells were treated (at t = 0) with the equitoxic
concentrations of compounds corresponding
to IC 50,72h or 3 × IC 50,72h , as determined
by MTT ( Table 1 ). Although the cells were not dead yet with a compromised
cell membrane
in the time scale of the experiment, their morphology was significantly
affected by the treatment with Os3 or Os6 , as indicated in Figure 4 . This revealed physiological changes in MDA-MB-231 cells
caused by Os3 and Os6 , especially at longer
times and/or higher concentrations. Thus, not only was cell growth
inhibited but the cells also showed significant changes in their morphology.
Changes in the cell structure are thought to be due to the rearrangement
of cytoskeletal proteins and are critically involved in the transformation
of adhesion and polarized cell migration required for the success
of the metastatic process. 31 − 33 Figure 4 Phase-contrast images of MDA-MB-231 taken
at 24, 48, and 72 h of
incubation with Os3 or Os6 at indicated
concentrations. Untreated MDA-MB-231 cells (C) showed an elongated
and spindle-shaped morphology with large protruding lamellipodia.
After treatment, cells become round-shaped with shorter lamellipodia
(the representative cells of this morphology are indicated by arrows).
For better resolution, the bottom two panels show a magnified section
of the image of untreated cells (C) and cells after treatment with Os3 (1 × IC 50 ), both at 72 h. In all images,
the scale bar represents 50 μm.
## Antiproliferative Effect of Os Complexes in Three-Dimensional
(3D) Cell Culture
Antiproliferative Effect of Os Complexes in Three-Dimensional
(3D) Cell Culture Although cell cultures grown in 2D monolayer
are the most frequently used for testing the biological activity of
various metallodrugs, three-dimensional (3D) cell cultures are assumed
to be a more representative model for in vitro anticancer drug screening. 34 , 35 Cells growing in 3D cultures possess several features of “in
vivo” tumors, such as hypoxia, cell–cell interaction,
drug penetration, and production/deposition of the extracellular matrix. 36 , 37 Therefore, the effect of the two selected complexes, Os3 and Os6 , was also tested on 3D cultures of MDA-MB-231
cells to provide more relevant data on its antitumor activity ( Figures 5 and S28 ). Figure 5 Representative images of MDA-MB-231 spheroids
untreated (A) or
treated with complex Os3 at concentration 0.62 (B), 1.25
(C), 2.5 μM (D), complex Os6 at 2.5 μM (E),
and cisplatin at 50 μM (F). The concentrations used in panels
(B,E) roughly correspond to the IC 50 values found for Os3 and Os6 , respectively. Scale bars represent
100 μm. MDA-MB-231 mammospheres were markedly
more sensitive to the investigated
osmium complexes than to conventional cisplatin, and complex Os3 containing the electron-donating substituent NMe 2 was significantly more potent compared to Os6 ( Figure 5 and Table 2 ). These results confirm the
trend in antiproliferative activity found for 2D monolayer MDA-MB-231
cells ( Table 1 ); however,
the difference between the antiproliferative activities of the two
complexes is less pronounced. This may reflect properties typical
for 3D but not for 2D cultures, such as different penetration to the
cells inside 3D spheroids. Table 2 IC 50 Values a (μM) Obtained for the Investigated Os Compounds
in
MDA-MB-231 Derived Mammospheres Determined Using CellTiter-Glo 3D
Cell Viability Assay IC 50 (μM) Os3 0.82 ± 0.05 Os6 2.2 ± 0.1 cisplatin 59 ± 6 a Data represent
mean values ±
SD from three independent experiments.
## Determination of Intracellular Reactive Oxygen Species
Determination of Intracellular Reactive Oxygen Species In general, the redox activity of Os(II) complexes is associated
with the formation of reactive oxygen species (ROS) in cells. 12 In this context, many previously reported osmium
compounds had been shown to induce oxidative stress in cancer cells. 38 − 42 To assess the causative role of oxidative stress in the biological
effects of the complexes tested in this study, the generation of ROS
by complexes Os3 and Os6 was investigated
by the CellROX green assay. Although menadiol (a positive control)
was significantly active in this experiment, levels of ROS in MDA-MB-231
cells indicated upon exposure to a wide range of drug concentrations
were not elevated for both Os complexes ( Figure S29 ). This suggests that increased ROS production was unlikely
to play a role in the biological activity of these Os(II) benzimidazole
complexes.
## Effect on Calcium Homeostasis
Effect on Calcium Homeostasis Based
on the abovementioned
results, oxidative stress due to ROS formation was ruled out as a
possible mechanism of action. Thus, the biological effects must therefore
be related to another mechanism. A number of previously reported osmium
(and ruthenium) compounds are assumed to induce cell death through
activation of the ER stress pathway. 14 , 43 − 45 These findings led us to investigate the possibility that Os(II)
benzimidazole complexes may induce ER stress as well. The ER
is a cellular organelle crucial for peptide synthesis and maturation,
lipid synthesis, detoxification of chemicals, and, importantly, calcium
(Ca 2+ ) storage. 46 An elevated
endoplasmic Ca 2+ level relative to the cytosol is of critical
importance for cells because of its role in regulating a variety of
cellular processes. Frequently, ER stress leads to the release of
Ca 2+ from the ER lumen; 47 therefore,
the changes in Ca 2+ levels are considered a reliable marker
for ER stress. 48 Calcium release
from ER into the cytoplasm was studied using the
calcium-sensitive fluorescent probe Fluo-4 AM. As indicated in Figure 5 , incubation with
the investigated Os complexes resulted in a significant elevation
of cytoplasmic Ca 2+ concentration even after a short incubation
time; the effect was both concentration ( Figure 6 A,B) and time ( Figure 6 C) dependent. Interestingly, Os3 was roughly 10-fold more effective than Os6 ( Figure 6 C), reflecting their
antiproliferative potency (IC 50 values differ by ca. 10-fold, Table 1 ). This suggests that
the antiproliferative effects of the Os complexes tested in this work
may be closely related to the loss of Ca 2+ homeostasis
and disruption of Ca 2+ signaling. Figure 6 Cytoplasmic calcium level
in MDA-MB-231 cells determined by the
Fluo-4 reagent. MDA-MB-231 cells were treated with indicated concentrations
of Os complexes. Cytoplasmic calcium level was measured immediately
after the treatment. (A,B) Cells were treated with various concentrations
of Os3 or Os6 for 2 (A) or 24 h (B) in the
dark. (C) Comparison of the values obtained for equipotent concentrations
of Os3 and Os6 . The values represent the
fluorescence intensity (median) related to the value found for control,
untreated cells. However, the treatment-associated
elevation of cytoplasmic Ca 2+ may depend on interference
with calcium homeostasis systems
other than ER. Therefore, to further support the view that Os(II)
benzimidazole belongs to the ER stress inductors, we analyzed the
expression of key biomarkers of the ER stress pathway. 13 Using qRT-PCR, we found that the expression
of several biomarkers of this pathway was significantly affected by
Os complexes, such as Bip, Ero1-Lα, IRE1α, and CHOP ( Figures 7 and S30 ), so that the level of particular mRNAs was
2.5–4.9 above the level found in untreated cells. The effect
was dependent on incubation time and was very similar for both, Os3 and Os6 when applied in equitoxic concentrations
( Figure S30 ). Figure 7 qRT-PCR of the ER stress
markers in MDA-MB-231 cells treated with
the tested Os3 complex. Cells were treated for 24 h at
the concentration corresponding to 3 × IC 50,72h . Relative
quantification of gene expression was calculated using the 2 –ΔΔ Ct method. The GAPDH gene was used as the endogenous
reference control, and samples isolated from the untreated cells were
used as the arbitrary calibrators. Data were subjected to statistical
analysis using Student’s t test and a significant
difference (* p ≤ 0.01) from untreated control
samples (dashed line). To confirm that the changes
in mRNA levels are translated into
the proteins, Western blotting analysis was performed. The results
clearly confirm the significantly increased expression of selected
ER markers ( Figure 8 ). The effect was both concentration- and time-dependent ( Figures 8 and S31 ). The quantitative analyses of the latter
results revealed that particularly Ire1α and CHOP were increased
dramatically; the protein levels in cells treated for 24 h with equitoxic
concentrations (3 × IC 50 ) of Os 3 or Os6 were increased ca. 15–20 times (Ire1α) or
even 130 times (CHOP), as compared to untreated cells. Hence, the
intensity of the induction suggested that the investigated Os complexes
are efficient inducers of at least some markers of ER stress, which
might be biologically relevant. Figure 8 (A) Western blot images of ER stress markers
and GAPDH in MDA-MB-231
cells non-treated (C) or treated with Os3 at 0.5, 1,
or 5 μM concentrations for 4, 14, or 24 h. (B) Western blot
images of ER stress markers and GAPDH in MDA-MB-231 cells non-treated
(C) or treated with Os3 or Os6 at their
equitoxic concentrations corresponding to 3 × IC 50,72h for 4, 14, and 24 h. For quantitative evaluation, see Figure S31 .
## Phototoxicity Testing
Phototoxicity Testing The photoactivatibility of the
complexes has been tested on three different human cancer cell lines,
namely, cervical adenocarcinoma HeLa, esophageal carcinoma OE33, and
melanoma A375 cells. These lines were chosen because these types of
tumor tissues are readily available for PDT treatment. The phototoxicity
data are summarized in Table 3 . As indicated, the antiproliferative activity of all investigated
complexes was promoted by irradiation with green light under normoxic
conditions. Among the tested compounds, Os1 was the most
sensitive to irradiation, demonstrating the highest phototoxicity
index (∼4) in all cell lines. As the complexes in the dark
do not show significant selectivity for tumor versus noncancerous
cells ( Table 1 ), their
photopotentiation may represent a considerable advantage. During photodynamic
chemotherapy, only tumor tissue is irradiated selectively so that
the photopotentiation at the site of the tumor can significantly increase
the difference between the effects on cancer and healthy (nonirradiated)
tissue. Table 3 IC 50 Values a (μM) Obtained for HeLa, OE33, and A375 Cancer Cells
Treated with the Investigated Os Complexes in the Dark or after Irradiation
by Green Light (1 h, λ max = 533 nm, 77 ± 3 W
m –2 ) Determined by the MTT Assay HeLa (normoxia) HeLa (hypoxia) OE33 (normoxia) A375 (normoxia) dark irrad PI dark irrad PI dark irrad PI dark irrad PI Os1 2.6 ± 0.4 0.6 ± 0.1 4.3 3.0 ± 0.4 1.5± 0.4 2.0 0.9 ± 0.1 0.21 ± 0.06 4.3 0.8 ± 0.1 0.19 ± 0.02 4.2 Os2 0.8 ± 0.2 0.31 ± 0.04 2.6 0.7 ± 0.1 0.6± 0.1 1.2 0.50 ± 0.08 0.19 ± 0.03 2.6 0.4 ± 0.1 0.19 ± 0.05 2.1 Os3 2.0 ± 0.3 0.9 ± 0.3 2.2 3.6 ± 0.5 2.2 ± 0.2 1.6 1.5 ± 0.4 0.9 ± 0.2 1.7 0.8 ± 0.2 0.44 ± 0.08 1.8 Os4 1.0 ± 0.3 0.5 ± 0.1 2.0 0.5 ± 0.1 0.41 ± 0.04 1.2 6 ± 1 3.3 ± 0.3 1.8 0.9 ± 0.2 0.5 ± 0.1 1.8 Os5 4.2 ± 0.8 1.6 ± 0.4 2.6 3.4 ± 0.6 2.4 ± 0.4 1.4 4 ± 1 2.0 ± 0.6 2.0 0.8 ± 0.2 0.6 ± 0.1 1.3 Os6 2.0 ± 0.6 1.5 ± 0.5 1.3 1.3 ± 0.4 1.1 ± 0.2 1.2 6 ± 1 5 ± 1 1.2 1.4 ± 0.1 1.4 ± 0.3 1.0 a Cells were treated with Os compounds
for 1 h in the dark followed by 1 h irradiation (or shame irradiation).
The assay was evaluated after 70 h post-incubation in a drug-free
medium. Normoxia (21% O 2, 5% CO 2 ), hypoxia (3%
O 2, 5% CO 2 ), PI (phototoxic index) = [IC 50 ] dark /[IC 50 ] irrad. The results
are expressed as mean values ± SD from at least three independent
experiments, each made in triplicate. The antiproliferative activity of Os(II) complexes
was also determined
under hypoxic conditions (3% O 2 ) in the model HeLa cells.
All investigated Os compounds showed significant activities even in
hypoxia ( Table 3 ),
both in the dark and after irradiation. Irradiation also led to a
photopotentiation in these hypoxic conditions, although the PI was
slightly lower for most complexes than that determined under a normal
oxygen concentration. In the case of Os4 , Os5 , and Os6 , the antiproliferative activity determined
after irradiation under hypoxic conditions was even similar to that
determined under normoxic conditions. The results thus suggest that
the investigated Os complexes might represent candidate compounds
for the therapeutic treatment of hypoxic tumors.
## Conclusions
Conclusions In this work, we have synthesized and characterized six octahedral
robust panchromatic osmium(II) complexes of the type [Os(C^N)(N^N) 2 ]OTf that show high photostability. An investigation of the
antiproliferative activity of the new compounds in the 2D monolayer
cancer cell lines and 3D multicellular tumor spheroids under dark
conditions and green light irradiation demonstrated that the new Os(II)
complexes, particularly complex Os3 , are markedly more
potent than clinically used cisplatin. The mechanism of antiproliferative
action of complexes has also been investigated and revealed that increased
ROS production was unlikely to play a role in the biological activity
of these Os(II) benzimidazole complexes. On the other hand, under
dark conditions, the investigated Os(II) complexes can activate the
ER stress pathway in cancer cells and disrupt calcium homeostasis.
In addition to the design of new Os(II) compounds of biological importance,
further expansion of the theoretical background for a deeper understanding
of osmium biology was also achieved. The presence of an ester as a
handle for further functionalization on the Os complexes developed
herein will optimize their cancer cell selectivity by varying the
nature of the targeting unit. It is also of note that some of the
new Os(II) complexes were photoactivated under hypoxic conditions
(3% in O 2 ) in HeLa cells, although only slightly ( Table 3 ). Thus, this observation
does not qualify these Os complexes as suitable candidates for clinical
photochemotherapy. On the other hand, because of the modular structure
of these scaffolds, they could enable the preparation of new libraries
of osmium PSs for photocytotoxicity and unlock the possibility of
exciting it at up to 900 nm. Overall, this study highlights the largely
unexplored potential of osmium-based complexes for cancer chemotherapy
and provides hints about the mechanism and targets of systemic osmium
toxicity.
## Experimental Section
Experimental Section General Remarks Synthesis-grade solvents were employed
in all cases. Deuterated solvents acetonitrile- d 3 and chloroform- d were purchased from Euriso-top.
The diamine precursor A was obtained, as previously described. 17 All other reagents were obtained from commercial
sources. All compounds are >96% pure by elemental analysis. Nuclear
magnetic resonance (NMR) spectra were recorded at 25 °C on a
Bruker AC 300E, Bruker AV 400, or Bruker AV 600 NMR spectrometer.
The corresponding deuterated solvent was used as an internal reference.
The solvents used were acetonitrile and DMSO, and their internal reference
was 1.94 and 2.50 ppm for 1 H spectra, respectively, and
1.32 and 39.52 ppm for 13 C. Elemental analyses were performed
on a LECO’s CHNS-932 Elemental Analyzer. UV–vis spectroscopy
was carried out on a PerkinElmer Lambda 750 S spectrometer with operating
software. ESI mass (positive mode) analyses were carried out on an
HPLC/MS TOF 6220. Synthesis and Characterization of Intermediates,
Ligands, and
Proligands Modified Procedure for the Synthesis of HL1 and
2-(3-Bromophenyl)-benzimidazole Derivative B Respective aldehyde (3 mmol) and sodium bisulfite (637 mg, 6 mmol)
were dissolved in water and stirred at 80 °C for 1 h. Then, the
diamine A (220 mg, 3 mmol) was dissolved in EtOH and
added to the solution. The mixture was stirred overnight at 90 °C.
EtOH was removed under reduced pressure, and an extraction was performed
with dichloromethane (3 × 15 mL). The final organic phase was
dried with anhydrous magnesium sulfate. The solvent was removed under
reduced pressure, and the corresponding product was obtained by adding
ethyl acetate and hexane. HL1 was obtained as a
yellow oil (95%); this modified procedure improves the yield previously
published by us. 17 HL1 was
used without further purification to synthesize the corresponding
osmium complexes. B was obtained as a white solid
(504 mg, 43.6%). 1 H NMR (401 MHz, chloroform- d ) δ:
8.54–8.49 (m, 1H), 8.06 (dd, J = 8.6, 1.6
Hz, 1H), 7.90 (t, J = 1.8 Hz, 1H), 7.66 (dddd, J = 8.6, 7.8, 1.8, 1.0 Hz, 2H), 7.47–7.40 (m, 2H),
4.30–4.20 (m, 2H), 3.96 (s, 3H), 1.87–1.74 (m, 2H),
1.29 (h, J = 7.3 Hz, 2H), 0.89 (t, J = 7.4 Hz, 3H). Synthesis of HL2 Intermediate B (387 mg, 1 mmol) and 4-(dimethylamino)phenylboronic acid
(198 mg,
1.2 mmol) were added to a microwave tube. Tetrakis(triphenylphosphine)palladium(0)
(58 mg, 0.05 mmol) was used as a catalyst, and potassium carbonate
(414.6, 3 mmol) was used as a base. The mixture was dissolved in 6
mL of toluene/H 2 O 2:1 and stirred under microwave at 120
°C for 1 h. Then, dichloromethane and water were added to perform
an extraction (3 × 15 mL of DCM). The organic phase was dried
with anhydrous magnesium sulfate, and the solvent was removed under
reduced pressure. The crude solid was purified in a silica column
with a solvent mixture of 6:4 hexane/ethyl acetate, the solvent was
removed, and the HL2 was precipitated with hexane. HL2 was obtained as a white solid (264 mg, 62%). 1 H NMR (401 MHz, chloroform- d ): δ
8.55 (dd, J = 1.6, 0.6 Hz, 1H), 8.05 (dd, J = 8.6, 1.6 Hz, 1H), 7.90 (m, 1H), 7.77–7.68 (m,
1H), 7.61–7.54 (m, 4H), 7.45 (dd, J = 8.6,
0.7 Hz, 1H), 6.87–6.77 (m, 2H), 4.29 (t, J = 7.66 Hz, 2H), 3.96 (s, 3H), 3.01 (s, 6H), 1.88–1.76 (m,
2H), 1.27 (m, 2H), 0.86 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (101 MHz, CDCl 3 ):
δ 167.60, 155.39, 149.89, 142.00, 138.48, 129.42, 128.42, 128.01,
127.36, 126.95, 125.18, 124.81, 121.96, 113.37, 110.16, 77.48, 52.33,
45.11, 41.01, 31.95, 20.06, 13.66. ESI-MS (positive ion mode): m / z = 428.2339 [M + H] + calcd m / z 428.2380. Anal. Calcd for C 27 H 29 N 3 O 2 : C, 75.85; H, 6.84; N, 9.83.
Found: C,
75.71; H, 6.83; N, 9.72. Synthesis of HL3 Intermediate B (387, 1 mmol), 4-(trifluoromethyl)phenylboronic acid (227.9
mg,
1.2 mmol), tetrakis(triphenylphosphine)palladium(0) (58 mg, 0.05 mmol),
and potassium carbonate (414.6, 3 mmol) were dissolved in 6 mL of
toluene/H 2 O 2:1 and stirred under microwave at 120 °C
for 1 h. After extraction with dichloromethane (3 × 15 mL), the
organic phase was dried with anhydrous magnesium sulfate, and the
solvent was removed under reduced pressure. The crude solid was purified
in a silica column with solvent mixture hexane: ethyl acetate 8:2
as the eluent. Then, the solvent was removed, and hexane was added
to obtain a white solid (240 mg, 53%). 1 H NMR (300
MHz, chloroform- d ): δ 8.55 (dd, J = 1.6, 0.6 Hz, 1H), 8.07 (dd, J = 8.5, 1.6 Hz,
1H), 7.98 (m, 1H), 7.80–7.77 (m, 1H), 7.77–7.73 (m,
4H), 7.72 (t, J = 1.6 Hz, 1H), 7.65 (m, 1H), 7.46
(dd, J = 8.5, 0.7 Hz, 1H), 4.35–4.25 (m, 2H),
3.97 (s, 3H), 1.95–1.73 (m, 2H), 1.30 (h, J = 7.4 Hz, 2H), 0.87 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (75 MHz, CDCl 3 ): δ
167.60, 154.96, 143.67, 142.71, 140.55, 138.85, 131.01, 129.45, 128.87,
128.72, 128.40, 127.52, 125.91, 125.86, 124.71, 124.45, 122.41, 109.85,
52.13, 44.84, 31.89, 19.93, 13.51. ESI-MS (positive ion mode): m / z = 453.1790 [M + H] + calcd m / z 453.1780. Anal. Calcd for C 26 H 23 N 2 F 3 O 2 : C, 69.02;
H, 5.12; N, 6.19.
Found: C, 69.06; H, 5.15; N, 5.98. Synthesis and Characterization
of Os(II) Complexes All osmium complexes were prepared following
the same synthetic route.
[Os(η 6 - p -cymene)Cl 2 ] 2 (80 mg, 0.1 mmol), potassium acetate (59 mg, 0.6 mmol), potassium
triflate (75.3 mg, 0.4 mmol), and the corresponding proligand (0.2
mmol), previously synthesized, were added to a microwave tube and
stirred at 80 °C for 1 h. Then, the mixture was filtered, and
the solvent was removed under reduced pressure. The crude product
was dissolved in methanol and used without further purification. Then,
the corresponding N^N ligand (0.3 mmol) was added to the solution
and stirred at 65 °C for 30 min. The solvent was removed, and
the crude solid was purified in alumina column chromatography with
a gradient from DCM/CH 3 CN 9:1 to DCM/CH 3 CN 1:1.
Finally, osmium complexes were recrystallized using dichloromethane
and hexane and filtered to obtain a dark-violet solid. [Os(bpy) 2 ( L1 )]CF 3 SO 3 ( Os1 ) HL1 (61.67 mg, 0.2 mmol)
was used as a proligand, and 2,2′-bipyridine (bpy) (62.5 mg,
0.4 mmol) was used as the N^N ligand. Os1 . Dark-violet
solid. Isolated yield: 22%. 1 H NMR (600 MHz, CD 3 CN): δ (ppm) 8.41 (d, J = 8.4, 1H), 8.36–8.27
(m, 3H), 7.96 (d, J = 7.8 Hz, 1H), 7.93–7.86
(m, 2H), 7.84–7.78 (m, 2H), 7.65 (s, 1H), 7.63–7.55
(m, 2H), 7.48 (t, J = 7.8 Hz, 1H), 7.40 (t, J = 7.8 Hz, 1H), 7.34 (t, J = 6.2 Hz, 1H),
7.08 (t, J = 6.2 Hz, 1H), 7.02 (t, J = 6.0 Hz, 1H), 6.99 (t, J = 6.0 Hz, 1H), 6.81–6.76
(m, 2H), 6.32 (s, 1H), 6.00 (s, 1H), 4.71 (t, J =
7.5 Hz, 2H), 3.70 (s, 2H), 2.01–1.91 (m, 2H), 1.41 (m, 2H),
0.93 (t, J = 7.4 Hz, 3H). 13 C{ 1 H} NMR (151 MHz, CD 3 CN): δ 167.83, 167.15, 163.00,
161.43, 159.68, 155.31, 151.87, 151.56, 150.62, 141.52, 140.62, 136.61,
134.39, 134.07, 133.85, 129.90, 128.57, 128.44, 128.03, 126.25, 125.88,
125.11, 124.53, 124.40, 124.31, 124.07, 123.26, 121.13, 117.01, 111.56,
52.34, 45.82, 32.40, 20.62, 14.07. ESI-MS (positive ion mode, CH 3 CN): m / z = 811.2449 [M] + calcd m / z 811.2431. Anal.
Calcd for C 40 H 35 N 6 O 5 F 3 SOs: C, 50.10; H, 3.68; N, 8.76; S, 3.34. Found: C, 50.14;
H, 3.86; N, 8.52; S, 3.41 (%). [Os(dpq) 2 ( L1 )]CF 3 SO 3 ( Os2 ) HL1 (61.67 mg, 0.2 mmol)
and dpq (93 mg, 0.4 mmol) were used following the procedure previously
described. Pure Os2 was obtained as a dark-violet
solid following the same purification procedure. Os2 . Dark-violet solid. Isolated yield: 25%. 1 H NMR (401
MHz, CD 3 CN): δ (ppm) 9.30 (d, J =
8.1 Hz, 1H), 9.14–9.09 (m, 3H), 9.08 (d, J = 2.2 Hz, 1H), 8.96 (d, J = 8.1 Hz, 1H),
8.88 (d, J = 8.1 Hz, 1H), 8.80 (d, J = 8.1 Hz, 1H), 8.49 (d, J = 5.6 Hz, 1H), 8.44 (d, J = 5.6 Hz, 1H), 8.33 (d, J = 5.3 Hz, 1H),
8.19 (d, J = 5.5 Hz, 1H), 7.95 (d, J = 7.8 Hz, 1H), 7.69 (m, 2H), 7.56 (dd, J = 8.1,
5.4 Hz, 1H), 7.51–7.45 (m, 2H), 7.37 (dd, J = 8.1, 5.5 Hz, 1H), 6.88 (t, J = 7.3 Hz, 1H), 6.70
(t, J = 7.1 Hz, 1H), 6.33–6.30 (m, 2H), 4.72
(t, J = 7.5 Hz, 2H), 3.60 (s, 3H), 1.99 (m, 2H),
1.43 (m, 2H), 0.94 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (151 MHz, CD 3 CN): δ 177.15,
167.83, 166.91, 156.87, 155.50, 154.15, 153.79, 153.29, 153.24, 152.46,
152.14, 147.24, 147.16, 147.08, 141.70, 141.43, 141.32, 141.19, 140.98,
140.37, 137.43, 136.39, 132.33, 131.08, 130.92, 130.79, 130.73, 130.68,
130.05, 129.94, 129.54, 128.25, 128.05, 127.95, 127.10, 125.99, 124.87,
122.44, 117.02, 111.70, 52.29, 45.93, 32.43, 20.66, 14.09. ESI-MS
(positive ion mode, CH 3 CN): m / z = 963.2564 [M] + calcd m / z 963.2554. Anal. Calcd for C 48 H 35 N 10 O 5 F 3 SOs: C, 51.88; H, 3.17; N,
12.61; S, 2.84. Found: C, 50.72; H, 3.07; N, 12.59; S, 2.79 (%). [Os(bpy) 2 ( L2 )]CF 3 SO 3 ( Os3 ) HL2 (85 mg, 0.2 mmol) was
used as the proligand to obtain the corresponding crude product intermediate,
and bipyridine (62.5 mg, 0.4 mmol) was used as the N^N ligand to obtain
the final dark-violet complex. Os3 . Dark-violet
solid. Isolated yield: 22%. 1 H NMR (401 MHz, CD 3 CN): δ (ppm) 8.44 (m, 2H), 8.35 (m, 2H), 8.19 (s, 1H), 8.01–7.87
(m, 2H), 7.81 (s, 1H), 7.76 (d, J = 8.6 Hz, 1H),
7.61 (m, 3H), 7.51 (s, 1H), 7.44 (m, 2H), 7.35 (d, J = 8.6 Hz, 3H), 7.13 (m, 2H), 7.06–6.95 (m, 2H), 6.82 ( J = 8.7 Hz, 2H), 6.21 (s, 1H), 5.59 (s, 1H), 4.78 (t, J = 7.6 Hz, 2H), 3.69 (s, 3H), 3.03 (s, 6H), 2.04 (m, 2H),
1.45 (m, 2H), 0.97 (t, J = 7.3 Hz, 3H). ESI-MS (positive
ion mode, CH 3 CN): m / z = 930.3078 [M] + calcd m / z 930.3166. Anal. Calcd for C 48 H 44 N 7 O 5 F 3 SOs: C, 53.47; H, 4.11; N, 9.09; S, 2.97.
Found: C, 53.49; H, 4.06; N, 9.13; S, 3.13 (%). [Os(dpq) 2 ( L2 )]CF 3 SO 3 ( Os4 ) HL2 (85 mg, 0.2 mmol) was
used as a proligand, and dpq (93 mg, 0.4 mmol) was used as the N^N
ligand to prepare the final violet complex. Os4 . Dark-violet solid. Isolated yield: 19.5%. 1 H NMR (401
MHz, CD 3 CN): δ (ppm): 9.33 (dd, J = 8.2, 1.2 Hz, 1H), 9.17–9.09 (m, 4H), 9.00 (dd, J = 8.1, 1.2 Hz, 1H), 8.93 (dd, J = 8.1,
1.1 Hz, 1H), 8.88 (dd, J = 8.2, 1.2 Hz, 1H), 8.59
(dd, J = 5.6, 1.3 Hz, 1H), 8.50 (d, J = 5.6 Hz, 1H), 8.35 (dd, J = 5.4, 1.3 Hz, 1H),
8.21 (d, J = 5.7 Hz, 1H), 8.10 (d, J = 1.8 Hz, 1H), 7.77–7.67 (m, 2H), 7.62 (dd, J = 8.2, 5.5 Hz, 1H), 7.61–7.49 (m, 2H), 7.46–7.36 (m,
3H), 6.95 (dd, J = 7.9, 1.7 Hz, 1H), 6.81–6.73
(m, 2H), 6.36–6.28 (m, 2H), 4.80 (t, J = 7.4
Hz, 2H), 3.61 (s, 3H), 2.93 (s, 6H), 2.07 (m, 2H), 1.57–1.40
(m, 2H), 0.98 (t, J = 7.4 Hz, 3H). 13 C{ 1 H} NMR (101 MHz, CD 3 CN): δ (ppm): 155.93,
152.34, 149.98, 146.30, 146.20, 146.13, 140.70, 140.52, 140.37, 140.28,
140.05, 139.42, 131.38, 130.12, 129.99, 129.84, 129.73, 129.22, 129.03,
127.27, 127.12, 126.98, 126.82, 125.01, 123.94, 116.03, 112.88, 110.69,
51.28, 45.08, 39.76, 31.37, 19.84, 13.13. ESI-MS (positive ion mode,
CH 3 CN): m / z = 1082.3292
[M] + calcd m / z : 1082.3289.
Anal. Calcd for C 56 H 44 N 11 O 5 F 3 SOs: C, 54.67; H, 3.6; N, 12.52; S, 2.61. Found: C,
54.61; H, 3.62; N, 12.55; S, 2.72 (%). [Os(bpy) 2 ( L3 )]CF 3 SO 3 ( Os5 ) HL3 (90 mg, 0.2 mmol) was
used as the C^N ligand, and bipyridine (62.5 mg, 0.4 mmol) was used
as the N^N ligand. After column purification, Os5 was
recrystallized using dichloromethane and ethyl ether (instead of hexane)
and filtered to obtain a dark-violet solid. Os5 . Dark-violet solid. Isolated yield: 29%. 1 H NMR (401
MHz, DMSO- d 6 ): δ 8.77 (d, J = 8.2 Hz, 1H), 8.74–8.60 (m, 3H), 8.25 (s, 1H),
8.05 (t, J = 7.8 Hz, 1H), 7.90 (d, J = 8.7 Hz, 1H), 7.87–7.69 (m, 8H), 7.64 (t, J = 7.7 Hz, 1H), 7.54 (t, J = 5.9 Hz, 3H), 7.32 (s,
1H), 7.22 (s, 3H), 6.37–5.86 (m, 2H), 5.02–4.90 (m,
2H), 3.69 (s, 3H), 1.98–1.91 (m, 2H), 1.46–1.26 (m,
2H), 0.88 (t, J = 7.4 z, 3H). ESI-MS (positive ion
mode, CH 3 CN): m / z = 955.2641
[M] + calcd m / z 955.2618.
Anal. Calcd for C 47 H 38 F 6 N 6 O 5 SOs: C, 51.17; H, 3.47; N, 7.62; S, 2.91. Found: C,
51.11; H, 3.39; N, 7.36; S, 2.96 (%). [Os(dpq) 2 ( L3 )]CF 3 SO 3 ( Os6 ) HL3 (90
mg, 0.2 mmol) was used as a proligand, and dpq was used as the N^N
ligand (93 mg, 0.4 mmol). Pure Os6 was obtained as a
dark-violet solid. Os6 . Dark-violet solid. Isolated
yield: 19.9%. 1 H NMR (600 MHz, CD 3 CN): δ
(ppm): 9.34 (d, J = 8.2, 1H), 9.17–9.10 (m,
4H), 9.02 (d, J = 8.1 Hz, 1H), 8.97 (d, J = 8.2 Hz, 1H), 8.89 (d, J = 8.2 Hz, 1H), 8.52 (d, J = 5.6 Hz, 1H), 8.46 (m, 1H), 8.34–8.30 (m, 1H),
8.19 (m, 2H), 7.77–7.69 (m, 6H), 7.66–7.60 (m, 1H),
7.59–7.53 (m, 2H), 7.42 (dd, J = 8.1, 5.5
Hz, 1H), 7.04 (d, J = 7.9 Hz, 1H), 6.36 (s, 1H),
6.32 (s, 1H), 4.82 (t, J = 7.6 Hz, 3H), 3.61 (s,
3H), 2.11–2.02 (m, 2H), 1.54–1.41 (m, 2H), 0.96 (t, J = 7.5 Hz, 3H). ESI-MS (positive ion mode, CH 3 CN): m / z = 1107.2747 [M] + calcd m / z : 1107.2741. Anal. Calcd
for C 55 H 38 N 10 F 6 O 5 SOs: C, 52.63; H, 3.05; N, 11.16; S, 2.55. Found: C, 52.53; H, 2.93;
N, 11.01; S, 2.62 (%). X-ray Structure Determinations Intensities
were registered
at low temperatures on a Bruker D8QUEST diffractometer using monochromated
Mo Kα radiation (λ = 0.71073 Å). Absorption corrections
were based on multi-scans (program SADABS). 49 Structures were refined anisotropically using SHELXL-2018. 50 Hydrogen atoms were included using rigid methyl
groups or a riding model. Special Features The structure contains
poorly resolved
regions of residual electron density; this could not be adequately
modeled and so was “removed” using the program SQUEEZE,
which is part of the PLATON system. 51 The
void volume per cell was 539 Å 3 , with a void electron
count per cell of 160. This additional solvent was not taken into
account when calculating derived parameters, such as the formula weight,
because the nature of the solvent was uncertain. Stability in
Cell Culture Medium The stability of complexes
in the cell culture medium was evaluated by UV–vis spectra
at t = 0 and after 48 h at 37 °C. Complexes
were dissolved in RPMI (5% DMSO) with 10 μM of concentration
for Os1 , Os2 , Os4 , and Os6 and 1 μM for Os3 and Os5 . Moreover, experimental details of the studies of HPLC-MS of all
complexes in RPMI are described in the Supporting Information . Photostability with White Light Irradiation The complexes
were dissolved in an air-saturated DMSO solution with 10 μM
of the concentration. For measuring the photostability, osmium compounds
were irradiated with white light (51 mW/cm 2 ) for 1.5 h.
The UV–vis spectra of complexes were recorded from 250 to 1000
nm. Singlet Oxygen Yields The procedure was adapted from
the literature. 52 , 53 Osmium complexes were dissolved
in air-saturated CH 3 CN solution with an approximate absorbance
of 0.06 at 520 nm. The solutions were irradiated with green light,
and the UV–visible spectra of DPBF were recorded every 30 s
for 4 min and a half. [Ru(bpy) 3 ](PF 6 ) 2 was used as a reference, in which absorbance at 520 nm and with
50 μM is 0.052. A PBS solution of DPBF without the PS was used
as a negative control. Singlet oxygen quantum yields were obtained
using the equation where Φ Δr is the singlet
oxygen quantum yield of the reference in acetonitrile (0.57), 31 Φ Δs is the singlet oxygen
quantum yield of each sample, m are the slopes of
samples, and reference and A λ are the absorbance
of complexes and reference at irradiation wavelength (520 nm). Biological
Studies Stock solutions of the Os complexes
were prepared by dissolving the compounds in DMSO to a final concentration
of 5 mM and subsequently diluted by culture medium to the required
concentration. To avoid DMSO toxicity, the final DMSO concentration
in the cell culture medium did not exceed 0.1% (v/v). Cell Lines
and Culture Conditions HeLa human cervix
adenocarcinoma cells, OE33 human Caucasian oesophageal carcinoma,
A375 human skin melanoma cells, highly invasive breast carcinoma MDA-MB-231
cells, human pancreatic cancer cell line PSN1, immortalized normal
adult human prostatic cells PNT1A, and human MRC-5 pd30 cells derived
from normal lung tissue were purchased from ECACC (UK). Human colorectal
carcinoma cells (HCT-116) and human breast cancer (MCF-7) cells were
kindly supplied by Professor B. Keppler, University of Vienna (Austria). PSN1, OE33, and PNT1A cells were cultured in RPMI medium (Biosera),
and all the other cells used in this work were kept in DMEM medium
(high glucose, 4.5 g L –1 , Biosera); both media were
supplemented with gentamycin (50 μg mL –1 )
and 10% heat-inactivated FBS (Biosera). The cells were cultivated
at 37 °C in a humidified 5% CO 2 atmosphere and periodically
subcultured to keep appropriate plating density. Antiproliferative
Activity Antiproliferative activities
of the investigated complexes in 2D cell cultures were determined
using a commonly used MTT assay. Briefly, the cells seeded in 96-well
tissue culture plates at a density of 5 × 10 3 cells/well
in 100 μL of medium were incubated overnight at 37 °C in
a 5% CO 2 humidified atmosphere. Afterward, the cells were
treated with the tested compounds in the concentration range of 0
to 100 μM and incubated for 72 h. After that, 20 μL of
a freshly diluted MTT solution (1.25 mg mL –1 in
PBS, Calbiochem, Darmstadt, Germany) was added, followed by a 4 h
incubation at 37 °C, 5% CO 2 . The medium was then removed,
and the resulting formazan product was dissolved in 100 μL of
DMSO. The cell viability was evaluated by measurement of the absorbance
at 570 nm using an absorbance reader (SPARK TECAN, SCHOELLER). At
least three independent experiments were performed, each of them made
in triplicate. The antiproliferative effectivities were expressed
as IC 50 values calculated from the curves constructed by
plotting relative absorbance (% of untreated control) versus drug
concentration (μM) (IC 50 = concentration of the agent
inhibiting cell population growth by 50%). The concentration of Os
complexes present in the medium during treatment was verified by flameless
atomic absorption spectrometry. Effects of the Os compounds
were also determined in the 3D culture of MDA-MB-231 cells. The cells
were seeded in ultra-low attachment 96-well plates at a density of
5000 cells/well in DMEM/F12 Ham medium supplemented with epidermal
growth factor (20 ng mL –1 ), BSA (1.5 mg mL –1 ), and B-27 supplement (2%, Invitrogen, Thermo Fisher Scientific
Inc., MA, USA) and allowed to grow for 4 days. The resulting 96 h
old spheroids were treated with the investigated compounds for an
additional 72 h. Treated spheroids were then monitored and transferred
to a black plate. One volume of the CellTiter-Glo 3D reagent (Promega,
Prague, Czech Republic) was added and incubated for 30 min. This 3D
assay reagent measures ATP as an indicator of viability and generates
a luminescence signal measured by a Tecan SPARK reader. IC 50 values were determined from the dose–response curves. To
determine IC 50 values, the CellTiter-Glo 3D cell viability
assay (Promega, Prague, Czech Republic) was used according to the
manufacturer’s protocol. Trypan Blue Exclusion Assay MDA-MB-231 cells, seeded
in 24-well plates in DMEM medium, were treated with Os complexes and
incubated at 37 °C in a 5% CO 2 . At certain incubation
intervals, cells were harvested, stained by trypan blue, and counted
by using BioRad TC10 Automated cell counter. Determination of Intracellular
ROS Intracellular ROS
were quantified in MDA-MB-231 cells. Cells were seeded on six-well
plates at a density of 3 × 10 5 cells per well. After
2 days, the cells were treated with Os complexes (0.1, 1, 5, or 10
μM) or menadiol (100 μM) for 2 h. After the incubation,
the cells were harvested, and 5 μM CellROX green reagent (Life
Technologies) was added to the cells and incubated for 30 min at 37
°C. Cells were then washed with PBS, and the fluorescence intensity
(exc. 488 nm, emis: 520 nm) was measured by the flow cytometer Cell
Stream (Amnis). Determination of the Cytoplasmic Ca 2+ Level Calcium release from ER into the cytoplasm was studied
using the
calcium-sensitive fluorescent probe Fluo-4 AM (Invitrogen, Thermo
Fisher Scientific). MDA-MB-231 cells were seeded on six-well plates
at a density of 3 × 10 5 cells per well. After 2 days,
the cells were treated with Os complexes at their various concentrations
or ionomycin (5 μM) for 2 or 24 h. Cells were harvested, stained
with the Fluo-4 reagent (5 μM), and incubated for 30 min at
37 °C. Cells were then washed with PBS, and the fluorescence
intensity (exc. 488 nm, emis: 520 nm) was measured by flow cytometer
Cell Stream (Amnis). qRT-PCR MDA-MB-231 cells were seeded
on six-well plates
at a density of 3 × 10 5 cells and incubated overnight.
Cells were then treated with Os complexes Os3 or Os6 (at various concentrations) for 4, 14, or 24 h. Following
washing, the cells were harvested, and total RNA was isolated using
NucleoSpin RNA columns (Machery Nagel, GE). One-step qPCR combining
reverse transcription followed by amplification thermal cycling was
applied using Luna universal one-step RT-qPCR (New England BioLabs,
MA, USA). Experiments were performed on Illumina Eco real-time PCR
(Illumina, CA, USA). The thermal profile was as follows: reverse transcription
for 10 min at 55 °C, initial denaturation for 1 min at 95 °C,
followed by 43 thermal cycles of denaturation for 10 s at 95 °C,
and extension for 30 s at 60 °C. Primer sequences: GAPDH-F:
GTCTCCTCTGACTTCAACAGCG, GAPDH-R: ACCACCCTGTTGCTGTAGCCAA; BiP(GRP78)-F:
CTGTCCAGGCTGGTGTGCTCT, BiP(GRP78)-R: CTTGGTAGGCACCACTGTGTTC, Calnexin-F:
GCTGGTTAGATGATGAGCCTGAG, Calnexin-R: ACACCACATCCAGGAGCTGACT, ERO1A-F:
GAAGGCTGTTCTTCAGTGGACC, ERO1A-R: CCCTTGTAACCAGTGTAGCGCT, IRE1-F: CCGAACGTGATCCGCTACTTCT,
IRE1-R: CGCAAAGTCCTTCTGCTCCACA, DDIT3 (CHOP)–F: GGTATGAGGACCTGCAAGAGGT,
DDIT3(CHOP)-R: CTTGTGACCTCTGCTGGTTCTG, PERK-F: GTCCCAAGGCTTTGGAATCTGTC,
PERK-R: CCTACCAAGACAGGAGTTCTGG, PDIA2-F: GCTGCTGTTTGTCAACCAGACG, PDIA2-R:
CCTCAGCCTTGAGTCCAAAGTAC purified primers were obtained from Generi
Biotech (Czech Republic). GAPDH was used as an internal control. The
relative expression of mRNA is represented as a fold increase (2 –ΔΔ Ct ). Immunoblotting
Experiments MDA-MB-231 cells were seeded
at a density of 3 × 10 5 cells/dish, grown overnight,
and incubated with Os complexes Os3 or Os6 (at various concentrations) for 4, 14, or 24 h. Following washing
with PBS, the cells were scraped into ice-cold PBS and pelleted. The
pellets were then lysed with RIPA buffer supplemented with proteinase
inhibitors according to the manufacturer’s recommendation (1
h on ice), and the extracts were cleared with centrifugation (15,000
rpm/10 min). Proteins containing supernatants were combined with 2×
Laemmli loading buffer (125 mM Tris–HCl, 20% glycerol, 10%
2-mercaptoethanol, 4% SDS, and 0.004% bromophenol blue) and heated
at 95 °C for 10 min. 4–20% SDS-PAGE (Mini-PROTEAN TGX
Precast Gel) was used to resolve the proteins. After transferring
to the PVDF membrane, the proteins were detected using appropriate
antibodies: BiP (C50B12) Rabbit (Cell Signaling), Calnexin (C5C9)
Rabbit (Cell Signaling), Ero1-Lα Antibody 3264 (Cell Signaling),
IRE1α (14C10) Rabbit (Cell Signaling), PDI (C81H6) Rabbit (Cell
Signaling), CHOP (L63F7) Mouse (Cell Signaling), PERK (D11A8) Rabbit
(Cell Signaling), GAPDH Mouse (Sigma-Aldrich), Anti-rabbit IgG, HRP-linked
Antibody (Cell Signaling), and Anti-mouse IgG, HRP-linked Antibody
(Cell Signaling). SignalFire ECL Reagent (A + B) was used as a substrate
for HRP, and the luminescence was recorded with Amersham Imager 680.
The densities in the images were assessed with Aida image analysis
software. Phototoxicity Testing The phototoxic
activity of Os
complexes was determined against human cervix adenocarcinoma cells
(HeLa), oesophageal carcinoma (OE33), and skin melanoma cells (A375).
Cells were seeded on 96-well tissue culture plates at a density of
5 × 10 3 cells/well (HeLa, A375) or 5.5 × 10 3 cells/well (OE33) in 100 μL of medium and cultured
under normoxic (21% O 2 , 5% CO 2 ) or hypoxic (3%
O 2 , 5% CO 2 ) conditions in a humidified incubator.
After overnight incubation, the medium was removed, the tested compound
diluted in Earle’s balanced salt solution (EBSS) was added,
and cells were incubated for 1 h in the dark. After the incubation
period, the cells were irradiated for 1 h (λ max =
533 nm) or left in the dark. Subsequently, EBSS was removed, and cells
were returned to the incubator in a complete drug-free culture medium.
The metabolic activity of the cells was determined 70 h after irradiation
using a standard MTT assay (absorbance measured at 570 nm). The IC 50 values were obtained from concentration–response
cell survival curves [cell survival (%) versus drug concentration
(μM)]. All experiments were carried out in triplicate, and at
least three independent experiments were performed.
## General Remarks
General Remarks Synthesis-grade solvents were employed
in all cases. Deuterated solvents acetonitrile- d 3 and chloroform- d were purchased from Euriso-top.
The diamine precursor A was obtained, as previously described. 17 All other reagents were obtained from commercial
sources. All compounds are >96% pure by elemental analysis. Nuclear
magnetic resonance (NMR) spectra were recorded at 25 °C on a
Bruker AC 300E, Bruker AV 400, or Bruker AV 600 NMR spectrometer.
The corresponding deuterated solvent was used as an internal reference.
The solvents used were acetonitrile and DMSO, and their internal reference
was 1.94 and 2.50 ppm for 1 H spectra, respectively, and
1.32 and 39.52 ppm for 13 C. Elemental analyses were performed
on a LECO’s CHNS-932 Elemental Analyzer. UV–vis spectroscopy
was carried out on a PerkinElmer Lambda 750 S spectrometer with operating
software. ESI mass (positive mode) analyses were carried out on an
HPLC/MS TOF 6220.
## Synthesis and Characterization of Intermediates,
Ligands, and
Proligands
Synthesis and Characterization of Intermediates,
Ligands, and
Proligands Modified Procedure for the Synthesis of HL1 and
2-(3-Bromophenyl)-benzimidazole Derivative B Respective aldehyde (3 mmol) and sodium bisulfite (637 mg, 6 mmol)
were dissolved in water and stirred at 80 °C for 1 h. Then, the
diamine A (220 mg, 3 mmol) was dissolved in EtOH and
added to the solution. The mixture was stirred overnight at 90 °C.
EtOH was removed under reduced pressure, and an extraction was performed
with dichloromethane (3 × 15 mL). The final organic phase was
dried with anhydrous magnesium sulfate. The solvent was removed under
reduced pressure, and the corresponding product was obtained by adding
ethyl acetate and hexane. HL1 was obtained as a
yellow oil (95%); this modified procedure improves the yield previously
published by us. 17 HL1 was
used without further purification to synthesize the corresponding
osmium complexes. B was obtained as a white solid
(504 mg, 43.6%). 1 H NMR (401 MHz, chloroform- d ) δ:
8.54–8.49 (m, 1H), 8.06 (dd, J = 8.6, 1.6
Hz, 1H), 7.90 (t, J = 1.8 Hz, 1H), 7.66 (dddd, J = 8.6, 7.8, 1.8, 1.0 Hz, 2H), 7.47–7.40 (m, 2H),
4.30–4.20 (m, 2H), 3.96 (s, 3H), 1.87–1.74 (m, 2H),
1.29 (h, J = 7.3 Hz, 2H), 0.89 (t, J = 7.4 Hz, 3H). Synthesis of HL2 Intermediate B (387 mg, 1 mmol) and 4-(dimethylamino)phenylboronic acid
(198 mg,
1.2 mmol) were added to a microwave tube. Tetrakis(triphenylphosphine)palladium(0)
(58 mg, 0.05 mmol) was used as a catalyst, and potassium carbonate
(414.6, 3 mmol) was used as a base. The mixture was dissolved in 6
mL of toluene/H 2 O 2:1 and stirred under microwave at 120
°C for 1 h. Then, dichloromethane and water were added to perform
an extraction (3 × 15 mL of DCM). The organic phase was dried
with anhydrous magnesium sulfate, and the solvent was removed under
reduced pressure. The crude solid was purified in a silica column
with a solvent mixture of 6:4 hexane/ethyl acetate, the solvent was
removed, and the HL2 was precipitated with hexane. HL2 was obtained as a white solid (264 mg, 62%). 1 H NMR (401 MHz, chloroform- d ): δ
8.55 (dd, J = 1.6, 0.6 Hz, 1H), 8.05 (dd, J = 8.6, 1.6 Hz, 1H), 7.90 (m, 1H), 7.77–7.68 (m,
1H), 7.61–7.54 (m, 4H), 7.45 (dd, J = 8.6,
0.7 Hz, 1H), 6.87–6.77 (m, 2H), 4.29 (t, J = 7.66 Hz, 2H), 3.96 (s, 3H), 3.01 (s, 6H), 1.88–1.76 (m,
2H), 1.27 (m, 2H), 0.86 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (101 MHz, CDCl 3 ):
δ 167.60, 155.39, 149.89, 142.00, 138.48, 129.42, 128.42, 128.01,
127.36, 126.95, 125.18, 124.81, 121.96, 113.37, 110.16, 77.48, 52.33,
45.11, 41.01, 31.95, 20.06, 13.66. ESI-MS (positive ion mode): m / z = 428.2339 [M + H] + calcd m / z 428.2380. Anal. Calcd for C 27 H 29 N 3 O 2 : C, 75.85; H, 6.84; N, 9.83.
Found: C,
75.71; H, 6.83; N, 9.72. Synthesis of HL3 Intermediate B (387, 1 mmol), 4-(trifluoromethyl)phenylboronic acid (227.9
mg,
1.2 mmol), tetrakis(triphenylphosphine)palladium(0) (58 mg, 0.05 mmol),
and potassium carbonate (414.6, 3 mmol) were dissolved in 6 mL of
toluene/H 2 O 2:1 and stirred under microwave at 120 °C
for 1 h. After extraction with dichloromethane (3 × 15 mL), the
organic phase was dried with anhydrous magnesium sulfate, and the
solvent was removed under reduced pressure. The crude solid was purified
in a silica column with solvent mixture hexane: ethyl acetate 8:2
as the eluent. Then, the solvent was removed, and hexane was added
to obtain a white solid (240 mg, 53%). 1 H NMR (300
MHz, chloroform- d ): δ 8.55 (dd, J = 1.6, 0.6 Hz, 1H), 8.07 (dd, J = 8.5, 1.6 Hz,
1H), 7.98 (m, 1H), 7.80–7.77 (m, 1H), 7.77–7.73 (m,
4H), 7.72 (t, J = 1.6 Hz, 1H), 7.65 (m, 1H), 7.46
(dd, J = 8.5, 0.7 Hz, 1H), 4.35–4.25 (m, 2H),
3.97 (s, 3H), 1.95–1.73 (m, 2H), 1.30 (h, J = 7.4 Hz, 2H), 0.87 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (75 MHz, CDCl 3 ): δ
167.60, 154.96, 143.67, 142.71, 140.55, 138.85, 131.01, 129.45, 128.87,
128.72, 128.40, 127.52, 125.91, 125.86, 124.71, 124.45, 122.41, 109.85,
52.13, 44.84, 31.89, 19.93, 13.51. ESI-MS (positive ion mode): m / z = 453.1790 [M + H] + calcd m / z 453.1780. Anal. Calcd for C 26 H 23 N 2 F 3 O 2 : C, 69.02;
H, 5.12; N, 6.19.
Found: C, 69.06; H, 5.15; N, 5.98.
## Modified Procedure for the Synthesis of
Modified Procedure for the Synthesis of HL1 and
2-(3-Bromophenyl)-benzimidazole Derivative B Respective aldehyde (3 mmol) and sodium bisulfite (637 mg, 6 mmol)
were dissolved in water and stirred at 80 °C for 1 h. Then, the
diamine A (220 mg, 3 mmol) was dissolved in EtOH and
added to the solution. The mixture was stirred overnight at 90 °C.
EtOH was removed under reduced pressure, and an extraction was performed
with dichloromethane (3 × 15 mL). The final organic phase was
dried with anhydrous magnesium sulfate. The solvent was removed under
reduced pressure, and the corresponding product was obtained by adding
ethyl acetate and hexane. HL1 was obtained as a
yellow oil (95%); this modified procedure improves the yield previously
published by us. 17 HL1 was
used without further purification to synthesize the corresponding
osmium complexes. B was obtained as a white solid
(504 mg, 43.6%). 1 H NMR (401 MHz, chloroform- d ) δ:
8.54–8.49 (m, 1H), 8.06 (dd, J = 8.6, 1.6
Hz, 1H), 7.90 (t, J = 1.8 Hz, 1H), 7.66 (dddd, J = 8.6, 7.8, 1.8, 1.0 Hz, 2H), 7.47–7.40 (m, 2H),
4.30–4.20 (m, 2H), 3.96 (s, 3H), 1.87–1.74 (m, 2H),
1.29 (h, J = 7.3 Hz, 2H), 0.89 (t, J = 7.4 Hz, 3H).
## Synthesis of
Synthesis of HL2 Intermediate B (387 mg, 1 mmol) and 4-(dimethylamino)phenylboronic acid
(198 mg,
1.2 mmol) were added to a microwave tube. Tetrakis(triphenylphosphine)palladium(0)
(58 mg, 0.05 mmol) was used as a catalyst, and potassium carbonate
(414.6, 3 mmol) was used as a base. The mixture was dissolved in 6
mL of toluene/H 2 O 2:1 and stirred under microwave at 120
°C for 1 h. Then, dichloromethane and water were added to perform
an extraction (3 × 15 mL of DCM). The organic phase was dried
with anhydrous magnesium sulfate, and the solvent was removed under
reduced pressure. The crude solid was purified in a silica column
with a solvent mixture of 6:4 hexane/ethyl acetate, the solvent was
removed, and the HL2 was precipitated with hexane. HL2 was obtained as a white solid (264 mg, 62%). 1 H NMR (401 MHz, chloroform- d ): δ
8.55 (dd, J = 1.6, 0.6 Hz, 1H), 8.05 (dd, J = 8.6, 1.6 Hz, 1H), 7.90 (m, 1H), 7.77–7.68 (m,
1H), 7.61–7.54 (m, 4H), 7.45 (dd, J = 8.6,
0.7 Hz, 1H), 6.87–6.77 (m, 2H), 4.29 (t, J = 7.66 Hz, 2H), 3.96 (s, 3H), 3.01 (s, 6H), 1.88–1.76 (m,
2H), 1.27 (m, 2H), 0.86 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (101 MHz, CDCl 3 ):
δ 167.60, 155.39, 149.89, 142.00, 138.48, 129.42, 128.42, 128.01,
127.36, 126.95, 125.18, 124.81, 121.96, 113.37, 110.16, 77.48, 52.33,
45.11, 41.01, 31.95, 20.06, 13.66. ESI-MS (positive ion mode): m / z = 428.2339 [M + H] + calcd m / z 428.2380. Anal. Calcd for C 27 H 29 N 3 O 2 : C, 75.85; H, 6.84; N, 9.83.
Found: C,
75.71; H, 6.83; N, 9.72.
## Synthesis of
Synthesis of HL3 Intermediate B (387, 1 mmol), 4-(trifluoromethyl)phenylboronic acid (227.9
mg,
1.2 mmol), tetrakis(triphenylphosphine)palladium(0) (58 mg, 0.05 mmol),
and potassium carbonate (414.6, 3 mmol) were dissolved in 6 mL of
toluene/H 2 O 2:1 and stirred under microwave at 120 °C
for 1 h. After extraction with dichloromethane (3 × 15 mL), the
organic phase was dried with anhydrous magnesium sulfate, and the
solvent was removed under reduced pressure. The crude solid was purified
in a silica column with solvent mixture hexane: ethyl acetate 8:2
as the eluent. Then, the solvent was removed, and hexane was added
to obtain a white solid (240 mg, 53%). 1 H NMR (300
MHz, chloroform- d ): δ 8.55 (dd, J = 1.6, 0.6 Hz, 1H), 8.07 (dd, J = 8.5, 1.6 Hz,
1H), 7.98 (m, 1H), 7.80–7.77 (m, 1H), 7.77–7.73 (m,
4H), 7.72 (t, J = 1.6 Hz, 1H), 7.65 (m, 1H), 7.46
(dd, J = 8.5, 0.7 Hz, 1H), 4.35–4.25 (m, 2H),
3.97 (s, 3H), 1.95–1.73 (m, 2H), 1.30 (h, J = 7.4 Hz, 2H), 0.87 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (75 MHz, CDCl 3 ): δ
167.60, 154.96, 143.67, 142.71, 140.55, 138.85, 131.01, 129.45, 128.87,
128.72, 128.40, 127.52, 125.91, 125.86, 124.71, 124.45, 122.41, 109.85,
52.13, 44.84, 31.89, 19.93, 13.51. ESI-MS (positive ion mode): m / z = 453.1790 [M + H] + calcd m / z 453.1780. Anal. Calcd for C 26 H 23 N 2 F 3 O 2 : C, 69.02;
H, 5.12; N, 6.19.
Found: C, 69.06; H, 5.15; N, 5.98.
## Synthesis and Characterization
of Os(II) Complexes
Synthesis and Characterization
of Os(II) Complexes All osmium complexes were prepared following
the same synthetic route.
[Os(η 6 - p -cymene)Cl 2 ] 2 (80 mg, 0.1 mmol), potassium acetate (59 mg, 0.6 mmol), potassium
triflate (75.3 mg, 0.4 mmol), and the corresponding proligand (0.2
mmol), previously synthesized, were added to a microwave tube and
stirred at 80 °C for 1 h. Then, the mixture was filtered, and
the solvent was removed under reduced pressure. The crude product
was dissolved in methanol and used without further purification. Then,
the corresponding N^N ligand (0.3 mmol) was added to the solution
and stirred at 65 °C for 30 min. The solvent was removed, and
the crude solid was purified in alumina column chromatography with
a gradient from DCM/CH 3 CN 9:1 to DCM/CH 3 CN 1:1.
Finally, osmium complexes were recrystallized using dichloromethane
and hexane and filtered to obtain a dark-violet solid. [Os(bpy) 2 ( L1 )]CF 3 SO 3 ( Os1 ) HL1 (61.67 mg, 0.2 mmol)
was used as a proligand, and 2,2′-bipyridine (bpy) (62.5 mg,
0.4 mmol) was used as the N^N ligand. Os1 . Dark-violet
solid. Isolated yield: 22%. 1 H NMR (600 MHz, CD 3 CN): δ (ppm) 8.41 (d, J = 8.4, 1H), 8.36–8.27
(m, 3H), 7.96 (d, J = 7.8 Hz, 1H), 7.93–7.86
(m, 2H), 7.84–7.78 (m, 2H), 7.65 (s, 1H), 7.63–7.55
(m, 2H), 7.48 (t, J = 7.8 Hz, 1H), 7.40 (t, J = 7.8 Hz, 1H), 7.34 (t, J = 6.2 Hz, 1H),
7.08 (t, J = 6.2 Hz, 1H), 7.02 (t, J = 6.0 Hz, 1H), 6.99 (t, J = 6.0 Hz, 1H), 6.81–6.76
(m, 2H), 6.32 (s, 1H), 6.00 (s, 1H), 4.71 (t, J =
7.5 Hz, 2H), 3.70 (s, 2H), 2.01–1.91 (m, 2H), 1.41 (m, 2H),
0.93 (t, J = 7.4 Hz, 3H). 13 C{ 1 H} NMR (151 MHz, CD 3 CN): δ 167.83, 167.15, 163.00,
161.43, 159.68, 155.31, 151.87, 151.56, 150.62, 141.52, 140.62, 136.61,
134.39, 134.07, 133.85, 129.90, 128.57, 128.44, 128.03, 126.25, 125.88,
125.11, 124.53, 124.40, 124.31, 124.07, 123.26, 121.13, 117.01, 111.56,
52.34, 45.82, 32.40, 20.62, 14.07. ESI-MS (positive ion mode, CH 3 CN): m / z = 811.2449 [M] + calcd m / z 811.2431. Anal.
Calcd for C 40 H 35 N 6 O 5 F 3 SOs: C, 50.10; H, 3.68; N, 8.76; S, 3.34. Found: C, 50.14;
H, 3.86; N, 8.52; S, 3.41 (%). [Os(dpq) 2 ( L1 )]CF 3 SO 3 ( Os2 ) HL1 (61.67 mg, 0.2 mmol)
and dpq (93 mg, 0.4 mmol) were used following the procedure previously
described. Pure Os2 was obtained as a dark-violet
solid following the same purification procedure. Os2 . Dark-violet solid. Isolated yield: 25%. 1 H NMR (401
MHz, CD 3 CN): δ (ppm) 9.30 (d, J =
8.1 Hz, 1H), 9.14–9.09 (m, 3H), 9.08 (d, J = 2.2 Hz, 1H), 8.96 (d, J = 8.1 Hz, 1H),
8.88 (d, J = 8.1 Hz, 1H), 8.80 (d, J = 8.1 Hz, 1H), 8.49 (d, J = 5.6 Hz, 1H), 8.44 (d, J = 5.6 Hz, 1H), 8.33 (d, J = 5.3 Hz, 1H),
8.19 (d, J = 5.5 Hz, 1H), 7.95 (d, J = 7.8 Hz, 1H), 7.69 (m, 2H), 7.56 (dd, J = 8.1,
5.4 Hz, 1H), 7.51–7.45 (m, 2H), 7.37 (dd, J = 8.1, 5.5 Hz, 1H), 6.88 (t, J = 7.3 Hz, 1H), 6.70
(t, J = 7.1 Hz, 1H), 6.33–6.30 (m, 2H), 4.72
(t, J = 7.5 Hz, 2H), 3.60 (s, 3H), 1.99 (m, 2H),
1.43 (m, 2H), 0.94 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (151 MHz, CD 3 CN): δ 177.15,
167.83, 166.91, 156.87, 155.50, 154.15, 153.79, 153.29, 153.24, 152.46,
152.14, 147.24, 147.16, 147.08, 141.70, 141.43, 141.32, 141.19, 140.98,
140.37, 137.43, 136.39, 132.33, 131.08, 130.92, 130.79, 130.73, 130.68,
130.05, 129.94, 129.54, 128.25, 128.05, 127.95, 127.10, 125.99, 124.87,
122.44, 117.02, 111.70, 52.29, 45.93, 32.43, 20.66, 14.09. ESI-MS
(positive ion mode, CH 3 CN): m / z = 963.2564 [M] + calcd m / z 963.2554. Anal. Calcd for C 48 H 35 N 10 O 5 F 3 SOs: C, 51.88; H, 3.17; N,
12.61; S, 2.84. Found: C, 50.72; H, 3.07; N, 12.59; S, 2.79 (%). [Os(bpy) 2 ( L2 )]CF 3 SO 3 ( Os3 ) HL2 (85 mg, 0.2 mmol) was
used as the proligand to obtain the corresponding crude product intermediate,
and bipyridine (62.5 mg, 0.4 mmol) was used as the N^N ligand to obtain
the final dark-violet complex. Os3 . Dark-violet
solid. Isolated yield: 22%. 1 H NMR (401 MHz, CD 3 CN): δ (ppm) 8.44 (m, 2H), 8.35 (m, 2H), 8.19 (s, 1H), 8.01–7.87
(m, 2H), 7.81 (s, 1H), 7.76 (d, J = 8.6 Hz, 1H),
7.61 (m, 3H), 7.51 (s, 1H), 7.44 (m, 2H), 7.35 (d, J = 8.6 Hz, 3H), 7.13 (m, 2H), 7.06–6.95 (m, 2H), 6.82 ( J = 8.7 Hz, 2H), 6.21 (s, 1H), 5.59 (s, 1H), 4.78 (t, J = 7.6 Hz, 2H), 3.69 (s, 3H), 3.03 (s, 6H), 2.04 (m, 2H),
1.45 (m, 2H), 0.97 (t, J = 7.3 Hz, 3H). ESI-MS (positive
ion mode, CH 3 CN): m / z = 930.3078 [M] + calcd m / z 930.3166. Anal. Calcd for C 48 H 44 N 7 O 5 F 3 SOs: C, 53.47; H, 4.11; N, 9.09; S, 2.97.
Found: C, 53.49; H, 4.06; N, 9.13; S, 3.13 (%). [Os(dpq) 2 ( L2 )]CF 3 SO 3 ( Os4 ) HL2 (85 mg, 0.2 mmol) was
used as a proligand, and dpq (93 mg, 0.4 mmol) was used as the N^N
ligand to prepare the final violet complex. Os4 . Dark-violet solid. Isolated yield: 19.5%. 1 H NMR (401
MHz, CD 3 CN): δ (ppm): 9.33 (dd, J = 8.2, 1.2 Hz, 1H), 9.17–9.09 (m, 4H), 9.00 (dd, J = 8.1, 1.2 Hz, 1H), 8.93 (dd, J = 8.1,
1.1 Hz, 1H), 8.88 (dd, J = 8.2, 1.2 Hz, 1H), 8.59
(dd, J = 5.6, 1.3 Hz, 1H), 8.50 (d, J = 5.6 Hz, 1H), 8.35 (dd, J = 5.4, 1.3 Hz, 1H),
8.21 (d, J = 5.7 Hz, 1H), 8.10 (d, J = 1.8 Hz, 1H), 7.77–7.67 (m, 2H), 7.62 (dd, J = 8.2, 5.5 Hz, 1H), 7.61–7.49 (m, 2H), 7.46–7.36 (m,
3H), 6.95 (dd, J = 7.9, 1.7 Hz, 1H), 6.81–6.73
(m, 2H), 6.36–6.28 (m, 2H), 4.80 (t, J = 7.4
Hz, 2H), 3.61 (s, 3H), 2.93 (s, 6H), 2.07 (m, 2H), 1.57–1.40
(m, 2H), 0.98 (t, J = 7.4 Hz, 3H). 13 C{ 1 H} NMR (101 MHz, CD 3 CN): δ (ppm): 155.93,
152.34, 149.98, 146.30, 146.20, 146.13, 140.70, 140.52, 140.37, 140.28,
140.05, 139.42, 131.38, 130.12, 129.99, 129.84, 129.73, 129.22, 129.03,
127.27, 127.12, 126.98, 126.82, 125.01, 123.94, 116.03, 112.88, 110.69,
51.28, 45.08, 39.76, 31.37, 19.84, 13.13. ESI-MS (positive ion mode,
CH 3 CN): m / z = 1082.3292
[M] + calcd m / z : 1082.3289.
Anal. Calcd for C 56 H 44 N 11 O 5 F 3 SOs: C, 54.67; H, 3.6; N, 12.52; S, 2.61. Found: C,
54.61; H, 3.62; N, 12.55; S, 2.72 (%). [Os(bpy) 2 ( L3 )]CF 3 SO 3 ( Os5 ) HL3 (90 mg, 0.2 mmol) was
used as the C^N ligand, and bipyridine (62.5 mg, 0.4 mmol) was used
as the N^N ligand. After column purification, Os5 was
recrystallized using dichloromethane and ethyl ether (instead of hexane)
and filtered to obtain a dark-violet solid. Os5 . Dark-violet solid. Isolated yield: 29%. 1 H NMR (401
MHz, DMSO- d 6 ): δ 8.77 (d, J = 8.2 Hz, 1H), 8.74–8.60 (m, 3H), 8.25 (s, 1H),
8.05 (t, J = 7.8 Hz, 1H), 7.90 (d, J = 8.7 Hz, 1H), 7.87–7.69 (m, 8H), 7.64 (t, J = 7.7 Hz, 1H), 7.54 (t, J = 5.9 Hz, 3H), 7.32 (s,
1H), 7.22 (s, 3H), 6.37–5.86 (m, 2H), 5.02–4.90 (m,
2H), 3.69 (s, 3H), 1.98–1.91 (m, 2H), 1.46–1.26 (m,
2H), 0.88 (t, J = 7.4 z, 3H). ESI-MS (positive ion
mode, CH 3 CN): m / z = 955.2641
[M] + calcd m / z 955.2618.
Anal. Calcd for C 47 H 38 F 6 N 6 O 5 SOs: C, 51.17; H, 3.47; N, 7.62; S, 2.91. Found: C,
51.11; H, 3.39; N, 7.36; S, 2.96 (%). [Os(dpq) 2 ( L3 )]CF 3 SO 3 ( Os6 ) HL3 (90
mg, 0.2 mmol) was used as a proligand, and dpq was used as the N^N
ligand (93 mg, 0.4 mmol). Pure Os6 was obtained as a
dark-violet solid. Os6 . Dark-violet solid. Isolated
yield: 19.9%. 1 H NMR (600 MHz, CD 3 CN): δ
(ppm): 9.34 (d, J = 8.2, 1H), 9.17–9.10 (m,
4H), 9.02 (d, J = 8.1 Hz, 1H), 8.97 (d, J = 8.2 Hz, 1H), 8.89 (d, J = 8.2 Hz, 1H), 8.52 (d, J = 5.6 Hz, 1H), 8.46 (m, 1H), 8.34–8.30 (m, 1H),
8.19 (m, 2H), 7.77–7.69 (m, 6H), 7.66–7.60 (m, 1H),
7.59–7.53 (m, 2H), 7.42 (dd, J = 8.1, 5.5
Hz, 1H), 7.04 (d, J = 7.9 Hz, 1H), 6.36 (s, 1H),
6.32 (s, 1H), 4.82 (t, J = 7.6 Hz, 3H), 3.61 (s,
3H), 2.11–2.02 (m, 2H), 1.54–1.41 (m, 2H), 0.96 (t, J = 7.5 Hz, 3H). ESI-MS (positive ion mode, CH 3 CN): m / z = 1107.2747 [M] + calcd m / z : 1107.2741. Anal. Calcd
for C 55 H 38 N 10 F 6 O 5 SOs: C, 52.63; H, 3.05; N, 11.16; S, 2.55. Found: C, 52.53; H, 2.93;
N, 11.01; S, 2.62 (%).
## [Os(bpy)
[Os(bpy) 2 ( L1 )]CF 3 SO 3 ( Os1 ) HL1 (61.67 mg, 0.2 mmol)
was used as a proligand, and 2,2′-bipyridine (bpy) (62.5 mg,
0.4 mmol) was used as the N^N ligand. Os1 . Dark-violet
solid. Isolated yield: 22%. 1 H NMR (600 MHz, CD 3 CN): δ (ppm) 8.41 (d, J = 8.4, 1H), 8.36–8.27
(m, 3H), 7.96 (d, J = 7.8 Hz, 1H), 7.93–7.86
(m, 2H), 7.84–7.78 (m, 2H), 7.65 (s, 1H), 7.63–7.55
(m, 2H), 7.48 (t, J = 7.8 Hz, 1H), 7.40 (t, J = 7.8 Hz, 1H), 7.34 (t, J = 6.2 Hz, 1H),
7.08 (t, J = 6.2 Hz, 1H), 7.02 (t, J = 6.0 Hz, 1H), 6.99 (t, J = 6.0 Hz, 1H), 6.81–6.76
(m, 2H), 6.32 (s, 1H), 6.00 (s, 1H), 4.71 (t, J =
7.5 Hz, 2H), 3.70 (s, 2H), 2.01–1.91 (m, 2H), 1.41 (m, 2H),
0.93 (t, J = 7.4 Hz, 3H). 13 C{ 1 H} NMR (151 MHz, CD 3 CN): δ 167.83, 167.15, 163.00,
161.43, 159.68, 155.31, 151.87, 151.56, 150.62, 141.52, 140.62, 136.61,
134.39, 134.07, 133.85, 129.90, 128.57, 128.44, 128.03, 126.25, 125.88,
125.11, 124.53, 124.40, 124.31, 124.07, 123.26, 121.13, 117.01, 111.56,
52.34, 45.82, 32.40, 20.62, 14.07. ESI-MS (positive ion mode, CH 3 CN): m / z = 811.2449 [M] + calcd m / z 811.2431. Anal.
Calcd for C 40 H 35 N 6 O 5 F 3 SOs: C, 50.10; H, 3.68; N, 8.76; S, 3.34. Found: C, 50.14;
H, 3.86; N, 8.52; S, 3.41 (%).
## [Os(dpq)
[Os(dpq) 2 ( L1 )]CF 3 SO 3 ( Os2 ) HL1 (61.67 mg, 0.2 mmol)
and dpq (93 mg, 0.4 mmol) were used following the procedure previously
described. Pure Os2 was obtained as a dark-violet
solid following the same purification procedure. Os2 . Dark-violet solid. Isolated yield: 25%. 1 H NMR (401
MHz, CD 3 CN): δ (ppm) 9.30 (d, J =
8.1 Hz, 1H), 9.14–9.09 (m, 3H), 9.08 (d, J = 2.2 Hz, 1H), 8.96 (d, J = 8.1 Hz, 1H),
8.88 (d, J = 8.1 Hz, 1H), 8.80 (d, J = 8.1 Hz, 1H), 8.49 (d, J = 5.6 Hz, 1H), 8.44 (d, J = 5.6 Hz, 1H), 8.33 (d, J = 5.3 Hz, 1H),
8.19 (d, J = 5.5 Hz, 1H), 7.95 (d, J = 7.8 Hz, 1H), 7.69 (m, 2H), 7.56 (dd, J = 8.1,
5.4 Hz, 1H), 7.51–7.45 (m, 2H), 7.37 (dd, J = 8.1, 5.5 Hz, 1H), 6.88 (t, J = 7.3 Hz, 1H), 6.70
(t, J = 7.1 Hz, 1H), 6.33–6.30 (m, 2H), 4.72
(t, J = 7.5 Hz, 2H), 3.60 (s, 3H), 1.99 (m, 2H),
1.43 (m, 2H), 0.94 (t, J = 7.3 Hz, 3H). 13 C{ 1 H} NMR (151 MHz, CD 3 CN): δ 177.15,
167.83, 166.91, 156.87, 155.50, 154.15, 153.79, 153.29, 153.24, 152.46,
152.14, 147.24, 147.16, 147.08, 141.70, 141.43, 141.32, 141.19, 140.98,
140.37, 137.43, 136.39, 132.33, 131.08, 130.92, 130.79, 130.73, 130.68,
130.05, 129.94, 129.54, 128.25, 128.05, 127.95, 127.10, 125.99, 124.87,
122.44, 117.02, 111.70, 52.29, 45.93, 32.43, 20.66, 14.09. ESI-MS
(positive ion mode, CH 3 CN): m / z = 963.2564 [M] + calcd m / z 963.2554. Anal. Calcd for C 48 H 35 N 10 O 5 F 3 SOs: C, 51.88; H, 3.17; N,
12.61; S, 2.84. Found: C, 50.72; H, 3.07; N, 12.59; S, 2.79 (%).
## [Os(bpy)
[Os(bpy) 2 ( L2 )]CF 3 SO 3 ( Os3 ) HL2 (85 mg, 0.2 mmol) was
used as the proligand to obtain the corresponding crude product intermediate,
and bipyridine (62.5 mg, 0.4 mmol) was used as the N^N ligand to obtain
the final dark-violet complex. Os3 . Dark-violet
solid. Isolated yield: 22%. 1 H NMR (401 MHz, CD 3 CN): δ (ppm) 8.44 (m, 2H), 8.35 (m, 2H), 8.19 (s, 1H), 8.01–7.87
(m, 2H), 7.81 (s, 1H), 7.76 (d, J = 8.6 Hz, 1H),
7.61 (m, 3H), 7.51 (s, 1H), 7.44 (m, 2H), 7.35 (d, J = 8.6 Hz, 3H), 7.13 (m, 2H), 7.06–6.95 (m, 2H), 6.82 ( J = 8.7 Hz, 2H), 6.21 (s, 1H), 5.59 (s, 1H), 4.78 (t, J = 7.6 Hz, 2H), 3.69 (s, 3H), 3.03 (s, 6H), 2.04 (m, 2H),
1.45 (m, 2H), 0.97 (t, J = 7.3 Hz, 3H). ESI-MS (positive
ion mode, CH 3 CN): m / z = 930.3078 [M] + calcd m / z 930.3166. Anal. Calcd for C 48 H 44 N 7 O 5 F 3 SOs: C, 53.47; H, 4.11; N, 9.09; S, 2.97.
Found: C, 53.49; H, 4.06; N, 9.13; S, 3.13 (%).
## [Os(dpq)
[Os(dpq) 2 ( L2 )]CF 3 SO 3 ( Os4 ) HL2 (85 mg, 0.2 mmol) was
used as a proligand, and dpq (93 mg, 0.4 mmol) was used as the N^N
ligand to prepare the final violet complex. Os4 . Dark-violet solid. Isolated yield: 19.5%. 1 H NMR (401
MHz, CD 3 CN): δ (ppm): 9.33 (dd, J = 8.2, 1.2 Hz, 1H), 9.17–9.09 (m, 4H), 9.00 (dd, J = 8.1, 1.2 Hz, 1H), 8.93 (dd, J = 8.1,
1.1 Hz, 1H), 8.88 (dd, J = 8.2, 1.2 Hz, 1H), 8.59
(dd, J = 5.6, 1.3 Hz, 1H), 8.50 (d, J = 5.6 Hz, 1H), 8.35 (dd, J = 5.4, 1.3 Hz, 1H),
8.21 (d, J = 5.7 Hz, 1H), 8.10 (d, J = 1.8 Hz, 1H), 7.77–7.67 (m, 2H), 7.62 (dd, J = 8.2, 5.5 Hz, 1H), 7.61–7.49 (m, 2H), 7.46–7.36 (m,
3H), 6.95 (dd, J = 7.9, 1.7 Hz, 1H), 6.81–6.73
(m, 2H), 6.36–6.28 (m, 2H), 4.80 (t, J = 7.4
Hz, 2H), 3.61 (s, 3H), 2.93 (s, 6H), 2.07 (m, 2H), 1.57–1.40
(m, 2H), 0.98 (t, J = 7.4 Hz, 3H). 13 C{ 1 H} NMR (101 MHz, CD 3 CN): δ (ppm): 155.93,
152.34, 149.98, 146.30, 146.20, 146.13, 140.70, 140.52, 140.37, 140.28,
140.05, 139.42, 131.38, 130.12, 129.99, 129.84, 129.73, 129.22, 129.03,
127.27, 127.12, 126.98, 126.82, 125.01, 123.94, 116.03, 112.88, 110.69,
51.28, 45.08, 39.76, 31.37, 19.84, 13.13. ESI-MS (positive ion mode,
CH 3 CN): m / z = 1082.3292
[M] + calcd m / z : 1082.3289.
Anal. Calcd for C 56 H 44 N 11 O 5 F 3 SOs: C, 54.67; H, 3.6; N, 12.52; S, 2.61. Found: C,
54.61; H, 3.62; N, 12.55; S, 2.72 (%).
## [Os(bpy)
[Os(bpy) 2 ( L3 )]CF 3 SO 3 ( Os5 ) HL3 (90 mg, 0.2 mmol) was
used as the C^N ligand, and bipyridine (62.5 mg, 0.4 mmol) was used
as the N^N ligand. After column purification, Os5 was
recrystallized using dichloromethane and ethyl ether (instead of hexane)
and filtered to obtain a dark-violet solid. Os5 . Dark-violet solid. Isolated yield: 29%. 1 H NMR (401
MHz, DMSO- d 6 ): δ 8.77 (d, J = 8.2 Hz, 1H), 8.74–8.60 (m, 3H), 8.25 (s, 1H),
8.05 (t, J = 7.8 Hz, 1H), 7.90 (d, J = 8.7 Hz, 1H), 7.87–7.69 (m, 8H), 7.64 (t, J = 7.7 Hz, 1H), 7.54 (t, J = 5.9 Hz, 3H), 7.32 (s,
1H), 7.22 (s, 3H), 6.37–5.86 (m, 2H), 5.02–4.90 (m,
2H), 3.69 (s, 3H), 1.98–1.91 (m, 2H), 1.46–1.26 (m,
2H), 0.88 (t, J = 7.4 z, 3H). ESI-MS (positive ion
mode, CH 3 CN): m / z = 955.2641
[M] + calcd m / z 955.2618.
Anal. Calcd for C 47 H 38 F 6 N 6 O 5 SOs: C, 51.17; H, 3.47; N, 7.62; S, 2.91. Found: C,
51.11; H, 3.39; N, 7.36; S, 2.96 (%).
## [Os(dpq)
[Os(dpq) 2 ( L3 )]CF 3 SO 3 ( Os6 ) HL3 (90
mg, 0.2 mmol) was used as a proligand, and dpq was used as the N^N
ligand (93 mg, 0.4 mmol). Pure Os6 was obtained as a
dark-violet solid. Os6 . Dark-violet solid. Isolated
yield: 19.9%. 1 H NMR (600 MHz, CD 3 CN): δ
(ppm): 9.34 (d, J = 8.2, 1H), 9.17–9.10 (m,
4H), 9.02 (d, J = 8.1 Hz, 1H), 8.97 (d, J = 8.2 Hz, 1H), 8.89 (d, J = 8.2 Hz, 1H), 8.52 (d, J = 5.6 Hz, 1H), 8.46 (m, 1H), 8.34–8.30 (m, 1H),
8.19 (m, 2H), 7.77–7.69 (m, 6H), 7.66–7.60 (m, 1H),
7.59–7.53 (m, 2H), 7.42 (dd, J = 8.1, 5.5
Hz, 1H), 7.04 (d, J = 7.9 Hz, 1H), 6.36 (s, 1H),
6.32 (s, 1H), 4.82 (t, J = 7.6 Hz, 3H), 3.61 (s,
3H), 2.11–2.02 (m, 2H), 1.54–1.41 (m, 2H), 0.96 (t, J = 7.5 Hz, 3H). ESI-MS (positive ion mode, CH 3 CN): m / z = 1107.2747 [M] + calcd m / z : 1107.2741. Anal. Calcd
for C 55 H 38 N 10 F 6 O 5 SOs: C, 52.63; H, 3.05; N, 11.16; S, 2.55. Found: C, 52.53; H, 2.93;
N, 11.01; S, 2.62 (%).
## X-ray Structure Determinations
X-ray Structure Determinations Intensities
were registered
at low temperatures on a Bruker D8QUEST diffractometer using monochromated
Mo Kα radiation (λ = 0.71073 Å). Absorption corrections
were based on multi-scans (program SADABS). 49 Structures were refined anisotropically using SHELXL-2018. 50 Hydrogen atoms were included using rigid methyl
groups or a riding model.
## Special Features
Special Features The structure contains
poorly resolved
regions of residual electron density; this could not be adequately
modeled and so was “removed” using the program SQUEEZE,
which is part of the PLATON system. 51 The
void volume per cell was 539 Å 3 , with a void electron
count per cell of 160. This additional solvent was not taken into
account when calculating derived parameters, such as the formula weight,
because the nature of the solvent was uncertain.
## Stability in
Cell Culture Medium
Stability in
Cell Culture Medium The stability of complexes
in the cell culture medium was evaluated by UV–vis spectra
at t = 0 and after 48 h at 37 °C. Complexes
were dissolved in RPMI (5% DMSO) with 10 μM of concentration
for Os1 , Os2 , Os4 , and Os6 and 1 μM for Os3 and Os5 . Moreover, experimental details of the studies of HPLC-MS of all
complexes in RPMI are described in the Supporting Information .
## Photostability with White Light Irradiation
Photostability with White Light Irradiation The complexes
were dissolved in an air-saturated DMSO solution with 10 μM
of the concentration. For measuring the photostability, osmium compounds
were irradiated with white light (51 mW/cm 2 ) for 1.5 h.
The UV–vis spectra of complexes were recorded from 250 to 1000
nm.
## Singlet Oxygen Yields
Singlet Oxygen Yields The procedure was adapted from
the literature. 52 , 53 Osmium complexes were dissolved
in air-saturated CH 3 CN solution with an approximate absorbance
of 0.06 at 520 nm. The solutions were irradiated with green light,
and the UV–visible spectra of DPBF were recorded every 30 s
for 4 min and a half. [Ru(bpy) 3 ](PF 6 ) 2 was used as a reference, in which absorbance at 520 nm and with
50 μM is 0.052. A PBS solution of DPBF without the PS was used
as a negative control. Singlet oxygen quantum yields were obtained
using the equation where Φ Δr is the singlet
oxygen quantum yield of the reference in acetonitrile (0.57), 31 Φ Δs is the singlet oxygen
quantum yield of each sample, m are the slopes of
samples, and reference and A λ are the absorbance
of complexes and reference at irradiation wavelength (520 nm).
## Biological
Studies
Biological
Studies Stock solutions of the Os complexes
were prepared by dissolving the compounds in DMSO to a final concentration
of 5 mM and subsequently diluted by culture medium to the required
concentration. To avoid DMSO toxicity, the final DMSO concentration
in the cell culture medium did not exceed 0.1% (v/v).
## Cell Lines
and Culture Conditions
Cell Lines
and Culture Conditions HeLa human cervix
adenocarcinoma cells, OE33 human Caucasian oesophageal carcinoma,
A375 human skin melanoma cells, highly invasive breast carcinoma MDA-MB-231
cells, human pancreatic cancer cell line PSN1, immortalized normal
adult human prostatic cells PNT1A, and human MRC-5 pd30 cells derived
from normal lung tissue were purchased from ECACC (UK). Human colorectal
carcinoma cells (HCT-116) and human breast cancer (MCF-7) cells were
kindly supplied by Professor B. Keppler, University of Vienna (Austria). PSN1, OE33, and PNT1A cells were cultured in RPMI medium (Biosera),
and all the other cells used in this work were kept in DMEM medium
(high glucose, 4.5 g L –1 , Biosera); both media were
supplemented with gentamycin (50 μg mL –1 )
and 10% heat-inactivated FBS (Biosera). The cells were cultivated
at 37 °C in a humidified 5% CO 2 atmosphere and periodically
subcultured to keep appropriate plating density.
## Antiproliferative
Activity
Antiproliferative
Activity Antiproliferative activities
of the investigated complexes in 2D cell cultures were determined
using a commonly used MTT assay. Briefly, the cells seeded in 96-well
tissue culture plates at a density of 5 × 10 3 cells/well
in 100 μL of medium were incubated overnight at 37 °C in
a 5% CO 2 humidified atmosphere. Afterward, the cells were
treated with the tested compounds in the concentration range of 0
to 100 μM and incubated for 72 h. After that, 20 μL of
a freshly diluted MTT solution (1.25 mg mL –1 in
PBS, Calbiochem, Darmstadt, Germany) was added, followed by a 4 h
incubation at 37 °C, 5% CO 2 . The medium was then removed,
and the resulting formazan product was dissolved in 100 μL of
DMSO. The cell viability was evaluated by measurement of the absorbance
at 570 nm using an absorbance reader (SPARK TECAN, SCHOELLER). At
least three independent experiments were performed, each of them made
in triplicate. The antiproliferative effectivities were expressed
as IC 50 values calculated from the curves constructed by
plotting relative absorbance (% of untreated control) versus drug
concentration (μM) (IC 50 = concentration of the agent
inhibiting cell population growth by 50%). The concentration of Os
complexes present in the medium during treatment was verified by flameless
atomic absorption spectrometry. Effects of the Os compounds
were also determined in the 3D culture of MDA-MB-231 cells. The cells
were seeded in ultra-low attachment 96-well plates at a density of
5000 cells/well in DMEM/F12 Ham medium supplemented with epidermal
growth factor (20 ng mL –1 ), BSA (1.5 mg mL –1 ), and B-27 supplement (2%, Invitrogen, Thermo Fisher Scientific
Inc., MA, USA) and allowed to grow for 4 days. The resulting 96 h
old spheroids were treated with the investigated compounds for an
additional 72 h. Treated spheroids were then monitored and transferred
to a black plate. One volume of the CellTiter-Glo 3D reagent (Promega,
Prague, Czech Republic) was added and incubated for 30 min. This 3D
assay reagent measures ATP as an indicator of viability and generates
a luminescence signal measured by a Tecan SPARK reader. IC 50 values were determined from the dose–response curves. To
determine IC 50 values, the CellTiter-Glo 3D cell viability
assay (Promega, Prague, Czech Republic) was used according to the
manufacturer’s protocol.
## Trypan Blue Exclusion Assay
Trypan Blue Exclusion Assay MDA-MB-231 cells, seeded
in 24-well plates in DMEM medium, were treated with Os complexes and
incubated at 37 °C in a 5% CO 2 . At certain incubation
intervals, cells were harvested, stained by trypan blue, and counted
by using BioRad TC10 Automated cell counter.
## Determination of Intracellular
ROS
Determination of Intracellular
ROS Intracellular ROS
were quantified in MDA-MB-231 cells. Cells were seeded on six-well
plates at a density of 3 × 10 5 cells per well. After
2 days, the cells were treated with Os complexes (0.1, 1, 5, or 10
μM) or menadiol (100 μM) for 2 h. After the incubation,
the cells were harvested, and 5 μM CellROX green reagent (Life
Technologies) was added to the cells and incubated for 30 min at 37
°C. Cells were then washed with PBS, and the fluorescence intensity
(exc. 488 nm, emis: 520 nm) was measured by the flow cytometer Cell
Stream (Amnis).
## Determination of the Cytoplasmic Ca
Determination of the Cytoplasmic Ca 2+ Level Calcium release from ER into the cytoplasm was studied
using the
calcium-sensitive fluorescent probe Fluo-4 AM (Invitrogen, Thermo
Fisher Scientific). MDA-MB-231 cells were seeded on six-well plates
at a density of 3 × 10 5 cells per well. After 2 days,
the cells were treated with Os complexes at their various concentrations
or ionomycin (5 μM) for 2 or 24 h. Cells were harvested, stained
with the Fluo-4 reagent (5 μM), and incubated for 30 min at
37 °C. Cells were then washed with PBS, and the fluorescence
intensity (exc. 488 nm, emis: 520 nm) was measured by flow cytometer
Cell Stream (Amnis).
## qRT-PCR
qRT-PCR MDA-MB-231 cells were seeded
on six-well plates
at a density of 3 × 10 5 cells and incubated overnight.
Cells were then treated with Os complexes Os3 or Os6 (at various concentrations) for 4, 14, or 24 h. Following
washing, the cells were harvested, and total RNA was isolated using
NucleoSpin RNA columns (Machery Nagel, GE). One-step qPCR combining
reverse transcription followed by amplification thermal cycling was
applied using Luna universal one-step RT-qPCR (New England BioLabs,
MA, USA). Experiments were performed on Illumina Eco real-time PCR
(Illumina, CA, USA). The thermal profile was as follows: reverse transcription
for 10 min at 55 °C, initial denaturation for 1 min at 95 °C,
followed by 43 thermal cycles of denaturation for 10 s at 95 °C,
and extension for 30 s at 60 °C. Primer sequences: GAPDH-F:
GTCTCCTCTGACTTCAACAGCG, GAPDH-R: ACCACCCTGTTGCTGTAGCCAA; BiP(GRP78)-F:
CTGTCCAGGCTGGTGTGCTCT, BiP(GRP78)-R: CTTGGTAGGCACCACTGTGTTC, Calnexin-F:
GCTGGTTAGATGATGAGCCTGAG, Calnexin-R: ACACCACATCCAGGAGCTGACT, ERO1A-F:
GAAGGCTGTTCTTCAGTGGACC, ERO1A-R: CCCTTGTAACCAGTGTAGCGCT, IRE1-F: CCGAACGTGATCCGCTACTTCT,
IRE1-R: CGCAAAGTCCTTCTGCTCCACA, DDIT3 (CHOP)–F: GGTATGAGGACCTGCAAGAGGT,
DDIT3(CHOP)-R: CTTGTGACCTCTGCTGGTTCTG, PERK-F: GTCCCAAGGCTTTGGAATCTGTC,
PERK-R: CCTACCAAGACAGGAGTTCTGG, PDIA2-F: GCTGCTGTTTGTCAACCAGACG, PDIA2-R:
CCTCAGCCTTGAGTCCAAAGTAC purified primers were obtained from Generi
Biotech (Czech Republic). GAPDH was used as an internal control. The
relative expression of mRNA is represented as a fold increase (2 –ΔΔ Ct ).
## Immunoblotting
Experiments
Immunoblotting
Experiments MDA-MB-231 cells were seeded
at a density of 3 × 10 5 cells/dish, grown overnight,
and incubated with Os complexes Os3 or Os6 (at various concentrations) for 4, 14, or 24 h. Following washing
with PBS, the cells were scraped into ice-cold PBS and pelleted. The
pellets were then lysed with RIPA buffer supplemented with proteinase
inhibitors according to the manufacturer’s recommendation (1
h on ice), and the extracts were cleared with centrifugation (15,000
rpm/10 min). Proteins containing supernatants were combined with 2×
Laemmli loading buffer (125 mM Tris–HCl, 20% glycerol, 10%
2-mercaptoethanol, 4% SDS, and 0.004% bromophenol blue) and heated
at 95 °C for 10 min. 4–20% SDS-PAGE (Mini-PROTEAN TGX
Precast Gel) was used to resolve the proteins. After transferring
to the PVDF membrane, the proteins were detected using appropriate
antibodies: BiP (C50B12) Rabbit (Cell Signaling), Calnexin (C5C9)
Rabbit (Cell Signaling), Ero1-Lα Antibody 3264 (Cell Signaling),
IRE1α (14C10) Rabbit (Cell Signaling), PDI (C81H6) Rabbit (Cell
Signaling), CHOP (L63F7) Mouse (Cell Signaling), PERK (D11A8) Rabbit
(Cell Signaling), GAPDH Mouse (Sigma-Aldrich), Anti-rabbit IgG, HRP-linked
Antibody (Cell Signaling), and Anti-mouse IgG, HRP-linked Antibody
(Cell Signaling). SignalFire ECL Reagent (A + B) was used as a substrate
for HRP, and the luminescence was recorded with Amersham Imager 680.
The densities in the images were assessed with Aida image analysis
software.
## Phototoxicity Testing
Phototoxicity Testing The phototoxic
activity of Os
complexes was determined against human cervix adenocarcinoma cells
(HeLa), oesophageal carcinoma (OE33), and skin melanoma cells (A375).
Cells were seeded on 96-well tissue culture plates at a density of
5 × 10 3 cells/well (HeLa, A375) or 5.5 × 10 3 cells/well (OE33) in 100 μL of medium and cultured
under normoxic (21% O 2 , 5% CO 2 ) or hypoxic (3%
O 2 , 5% CO 2 ) conditions in a humidified incubator.
After overnight incubation, the medium was removed, the tested compound
diluted in Earle’s balanced salt solution (EBSS) was added,
and cells were incubated for 1 h in the dark. After the incubation
period, the cells were irradiated for 1 h (λ max =
533 nm) or left in the dark. Subsequently, EBSS was removed, and cells
were returned to the incubator in a complete drug-free culture medium.
The metabolic activity of the cells was determined 70 h after irradiation
using a standard MTT assay (absorbance measured at 570 nm). The IC 50 values were obtained from concentration–response
cell survival curves [cell survival (%) versus drug concentration
(μM)]. All experiments were carried out in triplicate, and at
least three independent experiments were performed.