New cyclometalated iridium(III) complexes bearing substituted 2-(1H-benzimidazol-2-yl)quinoline: Synthesis, characterization, electrochemical and anticancer studies.

{"full_text": " Bioorganic Chemistry 151 (2024) 107706\n\n\n Contents lists available at ScienceDirect\n\n\n Bioorganic Chemistry\n journal homepage: www.elsevier.com/locate/bioorg\n\n\n\n\nNew cyclometalated iridium(III) complexes bearing substituted\n2-(1H-benzimidazol-2-yl)quinoline: Synthesis, characterization,\nelectrochemical and anticancer studies\nCigdem Sahin a, * , Dogukan Mutlu b, ** , Ahmet Erdem c , Rafet Kilincarslan d, *** , Sevki Arslan b\na\n Department of Engineering Basic Sciences, Faculty of Engineering and Natural Sciences, Istanbul Medeniyet University, Istanbul, Turkey\nb\n Department of Biology, Faculty of Science, Pamukkale University, Denizli, Turkey\nc\n Advanced Technology Application and Research Center, Pamukkale University, Denizli, Turkey\nd\n Department of Chemistry, Faculty of Science, Pamukkale University, Denizli, Turkey\n\n\n\n\nA R T I C L E I N F O A B S T R A C T\n\nKeywords: New iridium(III) compounds (C1\u2013C3) bearing 2-(1H-benzimidazol-2-yl)quinoline ligands with different side\nIridium complex groups (benzyl, 2,3,4,5,6-pentamethylbenzyl and 2,3,4,5,6-pentafluorobenzyl) were synthesized and charac-\n2-(1H-benzimidazol-2-yl)quinoline terized by using spectroscopic analyses. The effects of different side groups of iridium compounds on the pho-\nCytotoxicity\n tophysical and electrochemical properties have been investigated. The cytotoxicity and apoptosis of the\nApoptosis\n compounds have been evaluated on breast cancer cell lines using various methods including MTT assay, flow\n cytometry, qRT-PCR, and colony formation. The cytotoxicity of C1, expressed as IC50 values, was found to be\n 11.76 \u03bcM for MDA-MB-231 and 5.35 \u03bcM for MCF-7 cells. For C3, the IC50 value was 16.22 \u03bcM for MDA-MB-231\n and 8.85 \u03bcM for MCF-7 cells. In both cell lines, increased levels of Bax and caspase 3, along with downregulation\n of BCL-2 and positive annexin V staining, were observed, confirming apoptosis. Moreover, the colony-forming\n abilities in both cell lines decreased after C1 and C3 complex treatment. All these results suggest that the com-\n pounds C1 and C3 may have potential in the treatment of breast cancer, though further research is needed to\n confirm their efficacy.\n\n\n\n\n1. Introduction efforts in the investigation of new anti-cancer metallo drugs [7]. Platin-\n based drugs are used in the treatment of a range of cancers, such as\n Cancer is an important health problem that is growing rapidly on a bladder, ovarian, lung, neck and head cancer [7\u20139]. However, they have\nglobal scale [1,2]. Cancer includes hundreds of distinct types, each some disadvantages. The major obstacles to the development process\naffecting various organs, tissues, and cells (colon, liver, lung, breast, have been the intrinsic or acquired resistance and severe side effects\netc.). These malignancies manifest as carcinomas, lymphomas, sar- associated with platinum-based drugs [10\u201312]. In light of this under-\ncomas, or leukemias, each requiring specific therapeutic strategies [3]. standing, the evaluation of more effective, less toxic, non-resistant metal\nThe predominant clinical approaches for cancer treatment comprise complexes has attracted more attention [13]. Recently, organoiridium-\nchemotherapy, hormone therapy, radiation therapy, surgical interven- based compounds have been reported as anticancer agents that over-\ntion, and targeted therapy utilizing anticancer agents [4]. The need for come cisplatin resistance effectively or accelerate the death of cancer\nnovel and better pharmacological therapies for cancer treatment still cells by paraptotic, apoptotic, and autophagic ways [14,15]. The use of\nexists. The development of efficacious antineoplastic agents with low cyclometalated iridium(III) complexes as biosensing agents and bio-\ntoxicity and high specificity presents a significant challenge for the imaging is due to their good cell permeability and efficient photo-\nscientific community [4\u20136]. The efficiency of cisplatin and its related physical properties [16,17] depending on the nature and binding\ncompounds in overcoming cancer has triggered intensive research pattern of the ligand. The complexes have been implicated as selective\n\n\n\n * Corresponding author.\n ** Corresponding author.\n *** Corresponding author.\n E-mail addresses: cigdem.sahin@medeniyet.edu.tr (C. Sahin), dogukanmutlu@gmail.com (D. Mutlu), rkilincarslan@pau.edu.tr (R. Kilincarslan).\n\nhttps://doi.org/10.1016/j.bioorg.2024.107706\nReceived 28 June 2024; Received in revised form 30 July 2024; Accepted 6 August 2024\nAvailable online 8 August 2024\n0045-2068/\u00a9 2024 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies.\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\norganelle agents such as mitochondrion, nucleus, and endoplasmic re- 2.2.2. Synthesis of cyclometalated iridium(III) complexes (C1\u2013C3)\nticulum [18,19]. The enormous potential to be discovered as organelle- The cyclometalated iridium(III) complexes (C1\u2013C3) were synthesized\nselected anticancer agents increases the importance of cyclometalated according to literature procedure with some modifications [30]. Ir2(p-\niridium(III) complexes, biological activity can be perfected by ligand py)4Cl2 dimer (0.5 mmol) and the corresponding 2-(1H-benzimidazol-2-\ndesign [20]. The benzimidazole derivatives as ligands can allow the yl)quinoline ligand (L1, L2 or L3) (1.1 mmol) in 2-ethoxyethanol (10.0\nformation of diverse interactions with DNA which may provide high mL) were refluxed for 24 h under argon atmosphere. After cooling to\nselectivity and effective anticancer activity towards cancer cells [21,22]. room temperature, aqueous KPF6 was added to the reaction mixture.\nThe photophysical, photochemical, and biological activity of iridium The resulting orange precipitate was filtered and washed with deionized\ncomplexes are considerably tuned using various substituents on benz- water. Then, the crude product was purified by column chromatography\nimidazole ligands [23]. (silica gel: CH2Cl2/acetone (5/0.25) and an orange solid was obtained.\n Herein, we report the synthesis, characterization, and anticancer [Ir(ppy)2L1][PF6] (C1): 81 % yield. FTIR (ATR, cm\u2212 1): 3044, 1607,\nproperties of iridium(III) compounds (C1\u2013C3) bearing substituted 2-(1H- 1584, 1523, 1478, 1422, 1328, 1164, 834. 1H NMR (DMSO\u2011d6, 400\nbenzimidazol-2-yl)quinoline derivatives. The cytotoxicity and apoptosis MHz) \u03b4 ppm: 8.76 (d, J = 8.4 Hz, 1H, Ar-H), 8.51 (d, J = 9.2 Hz, 1H, Ar-\nof the compounds with different side groups (benzyl, 2,3,4,5,6-pentam- H), 8.25 (d, J = 8.4 Hz, 1H, Ar-H), 8.08 (d, J = 8.8 Hz, 2H, Ar-H), 8.03\nethylbenzyl and 2,3,4,5,6-pentafluorobenzyl) on 2-(1H-benzimidazol-2- (d, J = 8.4 Hz, 1H, Ar-H), 7.96\u20137.88 (m 4H, Ar-H), 7.82\u20137.75 (m, 3H, Ar-\nyl)quinoline have been evaluated on breast cancer cell lines (MDA-MB- H), 7.57 (t, J = 7.2 Hz, 1H, Ar-H), 7.40 (t, J = 7.2 Hz, 1H, Ar-H),\n231 and MCF-7) by the MTT assay, colony formation assay, flow 7.35\u20137.25 (m, 3H, Ar-H), 7.17 (t, J = 7.6 Hz, 1H, Ar-H), 7.12\u20137.08 (m,\ncytometry, and qRT-PCR methods. 4H, Ar-H), 7.04\u20136.93 (m, 4H, Ar-H), 6.89 (t, J = 7.6 Hz, 1H, Ar-H), 6.33\n (q, J = 18.0 Hz, 3H, Ar-H, N-CH2), 6.13 (d, J = 7.6 Hz, 1H, Ar-H), 6.01\n2. Experimental (d, J = 7.2 Hz, 1H, Ar-H). 13C NMR (DMSO\u2011d6, 100.57 MHz) \u03b4 ppm:\n 167.5, 166.8, 154.8, 152.9, 151.0, 149.2, 147.9, 144.6, 144.2, 141.6,\n2.1. Materials and methods 139.5, 139.0, 137.4, 136.0, 132.0, 130.7, 130.2, 129.6, 129.4, 129.2,\n 128.5, 128.3, 126.7, 126.4, 125.7, 125.3, 123.8, 123.0, 122.4, 121.5,\n All materials, reagents and solvents were purchased from commer- 120.3, 120.1, 113.2 (Ar-C) 49.2 (N-CH2) ESI-MS (m/z) = 836.02 [M-\ncial suppliers (Sigma-Aldrich and Merck) and used without further pu- PF6]+.\nrification. 2-(1H-benzimidazol-2-yl)quinoline (QuBim) [24\u201326], 2-(1- [Ir(ppy)2L2][PF6] (C2): 72 % yield. FTIR (ATR, cm\u2212 1): 3045, 2985,\nbenzyl-1H-benzimidazol-2-yl)quinoline (L1), 2-[1-(2,3,4,5,6-pentam- 1606, 1584, 1510, 1478, 1423, 1323, 1163, 837. 1H NMR (DMSO\u2011d6,\nethyl benzyl)-1H-benzimidazol-2-yl]quinoline (L2) [26,27] and Ir2(p- 400 MHz) \u03b4 ppm: 8.86 (d, J = 8.4 Hz, 1H, Ar-H), 8.67 (d, J = 8.4 Hz, 2H,\npy)4Cl2 (ppy: 2-phenylpyridine) [28] were synthesized as previously Ar-H), 8.20 (d, J = 8.4 Hz, 1H, Ar-H), 8.11 (d, J = 8.4 Hz, 1H, Ar-H), 8.06\ndescribed. FTIR-ATR spectra were recorded on Perkin Elmer Spectrum (d, J = 8.4 Hz, 1H, Ar-H), 7.98 (d, J = 9.6 Hz, 1H, Ar-H), 7.90\u20137.71 (m,\nTwo FT-IR Spectrometer. NMR spectra were acquired on a Varian 6H, Ar-H), 7.56 (t, J = 7.6 Hz, 1H, Ar-H), 7.52 (d, J = 5.6 Hz, 1H, Ar-H),\nMercury AS 400 NMR instrument at 400 MHz (1H) and 100.56 MHz 7.26 (t, J = 7.6 Hz, 1H, Ar-H), 7.18 (t, J = 7.2 Hz, 1H, Ar-H), 7.08\u20136.92\n(13C). The mass spectra were obtained from Thermo scientific TSQ (m, 6H, Ar-H), 6.85 (q, J = 8.4 Hz, 2H, N-CH2), 6.31 (d, J = 7.2 Hz, 1H,\nquantis LC-MS/MS system. The photoluminescence (PL) and UV\u2013Vis Ar-H), 6.09 (d, J = 7.6 Hz, 1H, Ar-H), 5.83 (d, J = 8.4 Hz, 1H, Ar-H), 2.46\nabsorption spectra were performed using Perkin Elmer LS55 fluores- (s, 15H, 2,3,4,5,6-(CH3)5-C6). 13C NMR (DMSO\u2011d6, 100.57 MHz) \u03b4 ppm:\ncence spectrometer and Shimadzu UV-1601 UV\u2013Vis spectrophotometer, 167.5, 166.8, 154.7, 153.2, 151.9, 151.1, 150.1, 147.9, 145.1, 144.6,\nrespectively. The PL quantum yields of the compounds were calculated 144.3, 139.4, 138.9, 137.4, 130.8, 130.2, 129.5, 129.2, 128.5, 128.3,\naccording to literature using Ru(bipyridine)3(PF6)2 as reference material 123.6, 122.9, 120.4, 120.1 (Ar-C), 117.7, 113.5, 53.4 (N-CH2), 17.9\n(\u03a6PL=0.095 in acetonitrile) [29]. Electrochemical studies were carried 2,3,4,5,6-(CH3)5-C6. ESI-MS (m/z) = 905.52 [M-PF6]+.\nout using Drop Sens \u00b5Stat 200 bipotentiostat in tetrabutylammonium [Ir(ppy)2L3][PF6] (C3): 78 % yield. FTIR (ATR, cm\u2212 1): 3052, 1607,\nhexafluorophosphate (TBAPF6) acetonitrile solution (0.1 M). Glassy 1587, 1505, 1478, 1425, 1331, 1125, 833. 1H NMR (DMSO\u2011d6, 400\ncarbon, silver wire and Pt wire counter were used as working electrode, MHz) \u03b4 ppm: 8.88 (d, J = 8.8 Hz, 1H, Ar-H), 8.69 (d, J = 8.8 Hz, 1H, Ar-\nreference electrode and counter electrode, respectively. H), 8.19 (d, J = 7.6 Hz, 1H, Ar-H), 8.08 (t, J = 8.0 Hz, 2H, Ar-H), 8.02 (d,\n J = 8.4 Hz, 1H, Ar-H), 7.93 (d, J = 5.2 Hz, 1H, Ar-H), 7.89\u20137.79 (m, 4H,\n2.2. Synthesis and characterization Ar-H), 7.75 (d, J = 6.8 Hz, 2H, Ar-H), 7.58 (t, J = 6.8 Hz, 1H, Ar-H), 7.41\n (t, J = 8.0 Hz, 1H, Ar-H), 7.17 (t, J = 6.8 Hz, 1H, Ar-H), 7.07 (t, J = 7.2\n2.2.1. Synthesis of 2-[1-(2,3,4,5,6-pentafluorobenzyl)-1H-benzimidazol-2- Hz, 1H, Ar-H), 7.00\u20136.94 (m, 4H, Ar-H), 6.87 (t, J = 7.6 Hz, 1H, Ar-H),\nyl]quinoline (L3) 6.47 (q, J = 17.6 Hz, 3H, Ar-H, N-CH2), 6.27 (d, J = 7.2 Hz, 1H, Ar-H),\n L3 ligand was synthesized starting from QuBim as in our previous 6.09 (d, J = 6.8 Hz, 1H, Ar-H), 5.97 (d, J = 8.8 Hz, 1H, Ar-H). 13C NMR\nreport [26,27]. QuBim (10.0 mmol) and KOH (10.0 mmol) were stirred (DMSO\u2011d6, 100.57 MHz) \u03b4 ppm: 167.4, 166.6, 155.2, 152.5, 151.03,\nin a Schlenk tube at 40 \u25e6 C for 2 h in toluene. At the end of the time, 149.0, 148.0, 146.6, 144.6, 144,09, 143.8, 141.5, 141.2, 139.3, 138.9,\n2,3,4,5,6-pentafluorobenzyl bromide (11.0 mmol) was added, and the 137.1, 131.96, 130.9, 130.3, 129.7, 129.3, 128.1, 125.7, 125.3, 124.2,\nmixture was refluxed for 8 h. The solvent was removed in vacuo, and the 123.5, 123.1, 122.4, 121.7, 120.3, 120.2, 118.0, 112.9 (Ar-C), 44.03 (N-\nresidue was filtered by adding CH2Cl2. The filtrate was allowed to CH2). ESI-MS (m/z) = 925.33 [M-PF6]+.\ncrystallize by adding hexane. 78 % yield. FTIR (ATR), cm\u2212 1): 3466,\n3056, 2941, 2857, 1950, 1929, 1887, 1810, 1737, 1641, 1615, 1598, 2.3. Cell culture and viability\n1565, 1498, 1444,1425, 1390, 1287, 1259, 1208, 1120, 1073, 921, 839,\n758, 716, 731. 1H NMR (CDCl3, 400 MHz, \u03b4 ppm): 6.67 (s, 2H, N-CH2); The human breast cell lines (MDA-MB-231 and MCF-7) and human\n7.32\u20137.36 (m, 2H, Ar-H); 7.39\u20137.43 (m, 1H, Ar-H); 7.59 (td, 1H, J = 7.5 embryonic kidney (HEK293) cell line were obtained from European\nHz, J = 1.2 Hz, J = 0.8 Hz, Ar-H); 7.75 (td, 1H, J = 7.7 Hz, J = 1.4 Hz, J Collection of Authenticated Cell Cultures (ECACC). Cells were main-\n= 1.4 Hz, Ar-H); 7.86\u20137.90 (m, 2H, Ar-H); 8.08 (d, 1H, J = 8.4 Hz, Ar-H); tained in DMEM or RPMI 1640 (Sigma-Aldrich, Germany) supplemented\n8.32 (d, 1H, J = 8.4 Hz, Ar-H); 8.57 (d, 1H, J = 8.4 Hz, Ar-H). 13C NMR with 10 % fetal bovine serum (FBS) (Capricorn, Germany) and 1 %\n(CDCl3, 100.56 MHz, \u03b4 ppm): 37,90 (N-CH2), 109,65, 120.68, 121.81, penicillin/streptomycin mix (Capricorn, Germany). The cells were\n123.25, 124.31, 127.47, 127.83, 127.87, 129.31, 130.00, 136.29, cultured in 100 mm diameter culture dishes at 37 \u25e6 C in a humidified\n136.95 (Ar-C, QuBim) 138.77, 139.57, 144.04, 146.51 (Ar-C, incubator containing 5 % CO2 and grown until 90 % confluent.\nC6(F)5\u20132,3,4,5,6) 142.58, 146.93, 149.76, 150.44 (Ar-C, QuBim). Approximately, 2 \u00d7 103 cells were seeded in 96-well plate (Costar,\n\n 2\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\nCorning, USA) and treated with various concentrations (15.6\u2013250 \u00b5M) determination of mRNA levels, the 2\u2212 \u0394\u0394Ct method was used as described\nof compounds dissolved in DMSO (not exceed 1 %) after 24 h as previously [34].\ndescribed previously [31]. 50 \u00b5M cisplatin was used as a positive con-\ntrol. After that, MTT solution (5 mg/mL) (Merck, Germany) was added 2.7. Statistical analysis\nto each well and incubated for 4 h. In each well, 50 \u00b5L dimethyl sulfoxide\n(DMSO) (Carlo Erba, Germany) was added to dissolve the formazan dye. GraphPad Prism 9.0 software was used for statistical analyses. The\nThe absorbance was measured by a microplate reader (Epoch, BioTek, results were presented as the means \u00b1 SD of at least three replicates. The\nUSA) at 590 nm. Cell viability was calculated as a percentage of the statistical differences between the groups were analyzed by One-way\ncontrol. The obtained data were used to estimate the 50 % inhibitory ANOVA. P-values < 0.05 were statistically significant.\nconcentration (IC50) values and calculations were evaluated by Graph-\nPad Prism\u00ae software v.9. 3. Results and discussion\n\n2.4. Colony formation 3.1. Synthesis and characterization\n\n To assess the effect of compounds on colony formation capabilities, The cyclometalated iridium compounds were synthesized using a\nMDA-MB-231 and MCF-7 cells were seeded in 6-well plates with 1 \u00d7 103 bridge-splitting reaction of Ir2(ppy)4Cl2 dimer with the corresponding 2-\ncells/well and treated for 24 h. Control cells were treated with DMSO (1H-benzimidazol-2-yl)quinoline ligand (L1, L2 or L3) in 2-ethoxyetha-\nonly (v/v). After 24 h, mediums were refreshed with culture medium nol under reflux conditions (Scheme 1) [30]. The compounds were ob-\nand maintained for at least one week. The cells were fixed with 100 % tained as their PF6 salts by ion exchange from Cl\u2212 to PF\u22126 . The\nmethanol for 10 min and then stained with 0.1 % crystal violet for 15 characterization of the compounds was analyzed by FTIR, mass, 1H and\n 13\nmin. After staining, the wells were washed with PBS 2\u20133 times and dried C NMR spectroscopies (Figs. S1\u2013S8). The FTIR spectra of the com-\novernight. The colonies were observed by inverted microscope, pounds (C1\u2013C3) show the characteristic vibration bands of C\u2013 \u2013N and\ncaptured, and analyzed by ImageJ software 1.53e as described previ- C\u2013\u2013C of 2-phenylpyridine and 2-(1H-benzimidazol-2-yl)quinoline li-\nously [32]. gands in the 1607\u20131422 cm\u2212 1 range. The strong band at around 836\n cm\u2212 1 is assigned to the PF\u22126 counter anion of the compounds [35]. In the\n 1\n H NMR spectra of the compounds (C1\u2013C3), the ratios of the aromatic\n2.5. Flow cytometry analysis\n peaks exhibit the presence of 2-(1H-benzimidazol-2-yl)quinoline and 2-\n phenylpyridine ligands between 5.83 and 8.88 ppm. The signal at\n The apoptosis was evaluated using the Annexin V-APC/7-AAD\n around 7.75 ppm was observed due to the proton adjacent to N atom of\nApoptosis Kit Detection (K101, BioVision) according to the manufac-\n 2-phenylpyridine [36]. The aromatic proton peaks of 2-(1H-benzimi-\nturer\u2019s instructions as described previously [33]. The MDA-MB-231 and\n dazol-2-yl)quinoline derivatives in the compounds (C1\u2013C3) at around\nMCF-7 cells were seeded in 6-well plates (3 \u00d7 104 cells/well) and treated\n 8.76, 8.67, 7.40 and 6.00 ppm are in good agreement with the reported\nwith C1 and C3 at IC50 concentration. 0.2 mM hydrogen peroxide (H2O2)\n iridium compounds bearing benzimidazole and 2-phenylpyridine li-\nwas used a positive control. After 24 h of incubation, cells were collected\n gands [30,37]. The peak at around 6.47 ppm was observed due to the\nwith 0.25 % Trypsin-EDTA. Afterwards, cells washed with PBS and\n benzylic CH2 protons of the benzimidazol fragment in the compounds.\nresuspended in cold binding buffer. Cells were stained with 10 \u00b5L pro-\n The characteristic signal of methyl group of L2 was appeared as a singlet\npidium iodide (PI) and 5 \u00b5L Annexin V-APC. After, cell suspensions were\n at 2.46 ppm for the compound C2. In the 13C NMR spectra of the com-\nincubated for 15 min in the darkroom. Lastly, 400 \u03bcl of Annexin V\n pounds, the signals of the cyclometalation carbon bound to iridium and\nbinding buffer was added to each tube and the samples were analyzed\n the carbon atom adjacent to N atom of 2-phenylpyridine atom were\nusing flow cytometry (CytoFlex, Beckman Coulter) to determine the\n observed at around 147.9 ppm and 151 ppm [36,38,39]. The signals at\npercentage of apoptotic cells with CytExpert Software.\n around 44 ppm are associated with the benzylic CH2 carbon of the\n benzimidazol fragment of the compounds (C1\u2013C3). The ESI mass spectra\n2.6. Quantitative real-time RT-PCR of C1\u2013C3 exhibited the parent molecular [M-PF6]+ which supported the\n formation of compounds.\n The effect of C1 and C3 on the expression of Bcl-2, BAX, CASP3,\nCASP8, and CASP9 genes in breast cancer cells was investigated by SYBR 3.2. The photophysical and electrochemical studies\ngreen quantitative PCR assay. The cancer cells (about 3 \u00d7 104 cells) were\ntreated with the compounds at IC50 concentration for 24 h, total RNA of The absorption and photoluminescence (PL) spectra of the com-\nthe cells was extracted using the innuPREP RNA Mini Kit 2.0 (Analytik pounds (C1\u2013C3) have been investigated at room temperature in aceto-\nJena, Germany), and OneScript\u00ae Plus cDNA Synthesis Kit (ABM, USA) nitrile solution (1 \u00d7 10\u2212 5 M) (Fig. 1 and Table 2). The absorption\nwas used for cDNA synthesis according to the manufacturer\u2019s in- maxima of C1\u2013C3 in the range 252\u2013300 nm with high molar extinction\nstructions. RT-PCR was performed using ABM KiloGreen 2X qPCR coefficient are associated with the localized \u03c0\u2013\u03c0* transitions of the 2-\nMasterMix (USA) in an Applied Biosystems\u2122 StepOnePlus\u2122 Real-Time (1H-benzimidazol-2-yl)quinoline and 2-phenylpyridine ligands. The\nPCR System (Thermo Fisher Scientific Inc., USA). GAPDH, a reliable band at around 365 nm is observed which is related to metal-to-ligand\nhousekeeping gene, was used as an internal control. The sequence of the charge-transfer (MLCT) transition [40]. PL spectra of the compounds\nprimers used in this study was presented in Table 1. For the exhibit a broad emission band centered at 634 nm for C1, 645 nm for C2\n and 636 nm for C3. The quantum yields of the compounds are found as\nTable 1 0.14 for C1, 0.11 for C2 and 0.10 for C3. The bathochromic shift of the\nThe sequences of primers used in this study. emission of C2 relative to those C1 and C3 are attributed the electron\n Genes Forward primer 5\u2032-3\u2032 Reverse primer 3\u2032-5\u2032 donor properties of methyl groups [41].\n The electrochemical measurements were performed using cyclic\n GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA\n Bcl-2 ATCGCCCTGTGGATGACTGAGT GTCTCCTCTGACTTCAACAGCG voltammetry in order to investigate the HOMO/LUMO energy levels and\n BAX GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA stability of iridium compounds. The compounds exhibit a reversible\n CASP3 GGAAGCGAATCAATGGACTCTGG GCATCGACATCTGTACCAGACC oxidation peak which is associated with the oxidation iridium metal\n CASP8 AGAAGAGGGTCATCCTGGGAGA TCAGGACTTCCTTCAAGGCTGC (Fig. 2 and Table 2). The oxidation potential of C2 with methyl groups on\n CASP9 GTTTGAGGACCTTCGACCAGCT CAACGTACCAGGAGCCACTCTT\n 2-(1H-benzimidazol-2-yl)quinoline ligand of the compound is shifted to\n\n 3\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\n\n\n Scheme 1. Reaction scheme for the synthesis of the cyclometalated Ir(III) complexes bearing N,N-type 2-(2\u2032-quinoly)benzimidazole ligands (C1\u2013C3).\n\n\n\n\nFig. 1. (a) Absorption spectra and (b) PL spectra of 1 \u00d7 10\u2212 5 M solutions of C1\u2013C3 in acetonitrile at room temperature. Excitation wavelengths are their lowest\nenergy MLCT absorption maxima.\n\n\n by the MTT assay. In the current study, different concentrations of the\nTable 2\n compounds (15.6\u2013250 \u00b5M) were attended for cytotoxicity in-\nPhotophysical and electrochemical data of C1\u2013C3 in acetonitrile.\n vestigations. After 24 h of exposure, the cytotoxicity of C1 to these cell\n Compound \u03bbmaks (Abs) \u03bbmaks Eox HOMO LUMO Eg lines (expressed as IC50 values) was found to be 11.76 \u00b5M for MDA-MB-\n (nm) (\u03b5/104 (V) (eV) (eV) (eV)\n (PL)\n 231, 5.35 \u00b5M for MCF-7, and 17.73 \u00b5M for HEK293, respectively. The\n M\u2212 1.cm\u2212 1) (nm)\n IC50 value of the C3 was found to be 16.22 \u00b5M for MDA-MB-231, 8.85 \u00b5M\n C1 252 (3.04); 634 1.34 \u2212 5.68 \u2212 2.97 2.71\n for MCF-7, and 20.07 \u00b5M for HEK293 cells.\n 298 (1.53);\n 360 (1.29)\n We observed that C1 and C3 exhibited a stronger cytotoxic effect on\n C2 255 (3.32); 645 1.24 \u2212 5.58 \u2212 2.89 2.69 MDA-MB-231 and MCF-7 cells than the HEK293 cell line. It is worth\n 300 (1.82); noting that C1 and C3 showed a higher selectivity index (SI) for MCF-7\n 365 (1.43) cells. Based on the ratio of the IC50 values for non-cancerous cells to\n C3 252 (2.90); 636 1.32 \u2212 5.66 \u2212 2.98 2.68\n breast cancer cells, C3 was 1.23 times more cytotoxic to MDA-MB-231\n 298 (1.54);\n 359 (1.27) cells and 2.26 times more cytotoxic to MCF-7 cells compared to\n HEK293 cells. Similarly, C1 exhibited cytotoxicity that was 1.50 times\n higher against MDA-MB-231 cells and 3.31 times higher against MCF-7\ncathodic area when compared to the C1 and C3 due to the electron donor cells than HEK293 cells (Table 3). Moreover, C1 and C3 exhibited an\nproperties of methyl groups. The HOMO and LUMO energy levels were antiproliferative effect on MDA-MB-231 (IC50 = 11.76 and 16.22 \u00b5M,\ndetermined by following equations [42,43]: EHOMO=-e(E1/2(ox.,onset) \u2212 respectively) and MCF-7 (IC50 = 5.35 and 8.85 \u00b5M, respectively), which\nE1/2(Fe) + 4.8) and ELUMO=EHOMO+Eg, including ferrocene value of 0.46 was better than cisplatin. C2 did not affect the viability in comparison to\nV vs. Ag/ Ag+. The calculated HOMO and LUMO energy levels of the C1 and C3 where we detected cytotoxic activity (Fig. 3). It is well\ncompounds are in the range of (\u2212 5.58)-(\u2212 5.68) eV and (\u2212 2.89-(\u2212 2.98)) established that side groups can affect the cytotoxicity of the compounds\neV, respectively. In consecutive voltammogram, the reversibility of [44]. Therefore, the side groups of the studied iridium complexes are\noxidation peaks and no important change in peak potentials show the different, and their cytotoxic effects have been observed differently.\nelectrochemical stability of the compounds. It is known and of interest that the activities of anticancer cyclo-\n metalated iridium(III) complexes is related to their ability to induce\n3.3. MTT assay mitochondria-mediated cell death pathway, deregulation of cellular\n redox balance, and inhibition of protein interactions [45\u201347]. It can be\n The cytotoxicity of C1, C2 and C3 evaluated against two breast cancer said that these complexes, kinetically inert under physiological condi-\ncell line (MDA-MB-231 and MCF-7) and non-cancerous HEK293 cell line tions, thereby exert their anticancer activity through non-covalent\n\n 4\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\n\n\nFig. 2. Cyclic voltammograms of C1\u2013C3 and consecutive cyclic voltammograms of C1 (inset) in acetonitrile solution containing 0.1 M TBAPF6 at a scan rate of 100\nmVs\u2212 1. Glassy carbon working electrode, silver wire reference electrode and Pt wire counter electrode were used in the three-electrode system.\n\n\n 3.5. Annexin V/PI staining\nTable 3\nIC50 values and selectivity index of C1, C2, and C3 on MDA-MB-231, MCF-7, and\n The APC Annexin V Apoptosis Detection Kit with 7-AAD was used to\nHEK293 cells.\n detect apoptosis. Cells showed a different pattern of cytotoxicity induced\n IC50 (\u00b5M) \u00b1 SD Selectivity Index (SI) by C1 and C3 after 24 h of exposure. Although early-apoptotic and\n MDA-MB- MCF-7 HEK293 HEK293/MDA- HEK293/ necrotic death were observed in MDA-MB-231 cells, late-apoptotic and\n 231 MB-231 MCF-7 necrotic death were seen in MCF-7 cells treated with iridium complexes\n C1 11.76 \u00b1 5.35 \u00b1 17.73 \u00b1 1.50 3.31 (Fig. 5). As shown in Fig. 5a, the percentages of apoptotic cells were\n 0.56 0.14 0.09 10.2 % and 19 % in MDA-MB-231 cells for C1 and C3, respectively,\n C2 >250 >250 >250 \u2212 \u2212\n compared with 11.1 % in the positive control (P < 0.05). Similarly, 26.5\n C3 16.22 \u00b1 8.85 \u00b1 20.07 \u00b1 1.23 2.26\n 0.08 0.77 0.28\n % and 28.3 % in MCF-7 cells for C1 and C3, respectively, compared with\n 39 % in the positive control (Fig. 5b, P < 0.05). Moreover, treatment of\n iridium complexes led to an apparent increase in the number of necrotic\ninteractions. In another study, iridium(III) complexes reduced cell pro- cells.\nliferation in human gastric carcinoma SGC-7901 cells [48]. Similarly, In our experiments, we were able to show that the cytotoxic activity\nhalf-sandwich iridium(III) complexes showed antiproliferative effects of cyclometalated iridium(III) complexes toward breast cancer cell can\nvia disrupting mitochondrial membrane potential and inducing oxida- be attributed to the effective induction of different types of cell death\ntive stress on MCF-7 breast cancer cells [49]. Moreover, different including apoptosis (Fig. 5, Table 4).\ncyclometalated iridium(III) complexes showed anticancer activities on\ncancer cells that were similar to our results [49\u201353]. 3.6. Gene expression analysis\n\n3.4. Colony formation To determine the alteration of apoptosis pathways by the C1 and C3,\n a qRT-PCR array was used to evaluate the expression levels of the Bax,\n 3\n The colony formation assay was evaluated by seeding 1 \u00d7 10 cells Bcl-2, caspase 3, 8, and 9 genes in MDA-MB-231 and MCF-7 cell lines.\nand treating with IC50 dose of iridium(III) complexes for 24 h. Colonies After the C1 treatment, Bax, caspase 3, 8, and 9 mRNA levels were\nwere stained with 0.1 % crystal violet and counted by ImageJ software. increased 1.59-, 1.65-, 2.5-, and 1.63- fold in MDA-MB-231 cells (P <\nFig. 2 showed that C1 and C3 could inhibit the proliferation of breast 0.05), respectively. Similarly, Bax, caspase 3, 8, and 9 mRNA levels were\ncancer cells MDA-MB-231 and MCF-7 only after 24 h (Fig. 4). increased 2.94-, 5.04-, 1.64-, and 1.43- fold in MDA-MB-231 cells,\n In consistent with our results, iridium complexes was caused inhi- respectively. On the contrary, C1 caused 57.0 and 31.2 % decreases in\nbition of cellular colonies of HeLa human cervical cancer cells [54]. Bcl-2 mRNA level in MDA-MB-231 and MCF-7 cell line when compared\nMoreover, Liu et al. have showed that the cyclometalated iridium to the control group (P < 0.05), respectively. Besides, RT-PCR results\ncomplex Ir-9-Ac inhibitory effects on colony formation on A549, A549R, showed C3 treatment caused 1.32-, 1.87-, 3.82-, and 4.09- fold increases\nA2780 and MCF-7 cells [55]. In another study, it was shown that in Bax, caspase 3, 8, and 9 mRNA levels in the MDA-MB-231 cell line (P\ncyclometalated iridium(III) complexes causes inhibition of the colony < 0.05), respectively. C3 caused 1.15-, 1.46-, 1.55-, and 1.04- fold in-\nformation in A549 lung cancer cells [56]. creases in Bax, caspase 3, 8, and 9 mRNA levels in MCF-7 cells, respec-\n tively. On the contrary, C3 caused 53.5 and 30.2 % decreases in Bcl-2\n mRNA level in MDA-MB-231 and MCF-7 cell line (P < 0.05, Table 3),\n\n 5\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\n\n\nFig. 3. The cytotoxic effects of C1, C2 and C3 against a. MDA-MB-231, b. MCF-7, and c. HEK293 cells. d. Cisplatin (50 \u00b5M) was used as a positive control. Data were\nmean values of two independent replicates. *: p < 0.05 compared with the control group.\n\n\n\n\nFig. 4. Estimation of the proliferation of a. MDA-MB-231 and b. MCF-7 cells using the colony formation assay. The C1 and C3 compounds (IC50 concentrations)\nalmost completely suppressed the colony formation.\n\n\nrespectively. complex triggers the activation of downstream caspases 3, -6, and -7, as\n Apoptosis induction involves two pathways: the extrinsic pathway, well as with other apoptotic effectors, consequently, the activation of\ndependent on death receptors, and the intrinsic pathway (mitochondria- the caspase-cascade system is the key event in mitochondria-dependent\ndependent) [57,58]. The mitochondria-mediated intrinsic apoptotic apoptosis [60].\npathway is primarily activated by the collapse of the mitochondrial We detected cyclometalated iridium(III) complexes that increased\nmembrane potential. Upon sense the cell death stimuli, mitochondria the pro-apoptotic mRNA levels and decreased anti-apoptotic mRNA\nrelease cytochrome c into the cytosol, where it binds with Apaf-1 and levels. Fig. 6 showed that C1 and C3 compounds caused increases in the\ncaspase-9, forming a complex termed the apoptosome [59]. This mRNA expression levels of caspase 3, 8, and 9 (pro-apoptotic) genes, and\n\n\n 6\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\n\n\nFig. 5. a. MDA-MB-231 and b. MCF-7 cells were assessed by flow cytometry using the Annexin V-APC/7-AAD apoptosis assay after 24 h exposure. (Q1-UL: dead\ncells; Q1-UR: late apoptosis; Q1-LL: viable cells; Q1-LR: early apoptosis).\n\n\n Furthermore, several previous studies proposed that necrotic cell\nTable 4\n death execution occurs independently of caspase activity [62\u201364].\nPercentages of viable, apoptotic, and necrotic cells detected in MDA-MB-231 and\n However, in the breast cancer cell model treated with iridium complexes\nMCF-7 cells after C1 and C3 treatment by flow cytometry analysis at 24 h.\n in this study, caspase activation induced concurrently with necrosis.\n Cell line Group Cell population (%) These findings suggest that apoptosis and necrosis may share common\n Viable Early Late Necrotic characteristics, including caspase activation and Bcl-2 family proteins.\n apoptotic apoptotic The result of this study demonstrated that iridium complexes exert\n MDA-MB- Control 96.96 1.79 1.03 0.23 cytotoxic effects by inducing necrosis and apoptosis in the MDA-MB-231\n 231 H2O2 87.82 8.75 2.71 0.72 and MCF-7 cells through a mitochondria-associated pathway.\n C1 58.51 9.21 1.01 31.28\n C3 11.93 19.08 0.05 68.93\n 4. Conclusion\n\n MCF-7 Control 92.72 3.12 2.90 1.26\n In this work, we have described the synthesis, characterization,\n H2O2 58.63 10.95 28.94 1.48\n C1 0.00 0.00 26.50 73.50 cytotoxicity, and apoptosis of iridium compounds bearing 2-(1H-ben-\n C3 0.00 0.00 28.33 71.67 zimidazol-2-yl)quinoline ligands. The compounds were synthesized\n using a bridge-splitting reaction of Ir2(ppy)4Cl2 dimer with the corre-\n sponding 2-(1H-benzimidazol-2-yl)quinoline ligand in 2-ethoxyethanol.\na decrease in Bcl-2 (anti-apoptotic) gene expression. C3 at a concentra- Our studies showed that C1 and C3 exhibited greater cytotoxic and\ntion of 8.85 \u03bcM increased the expression of caspase 9 (409.8 %) in MCF-7 apoptotic activity in MDA-MB-231 and MCF-7 cell lines. On the other\ncells more so than C1 (Fig. 6). Moreover, treatment of iridium(III) hand, the different patterns observed in the flow cytometry analysis\ncomplexes caused an increase in Bax/Bcl-2 ratio as well in both cell provided significant insights into the cell death induced by the com-\nlines. All these findings indicated that the cell death caused by these plexes. The results in this study indicate that cyclometalated iridium\ncompounds involved both intrinsic and extrinsic pathways of apoptosis. compounds may have significant potential for anticancer activity. But,\nIn accordance with our results, simultaneous occurrences of both forms they should be needed further experiments to test this hypothesis.\nof cell death are observed upon exposure to certain stimuli [61].\n\n\n\n\nFig. 6. Bax, Bcl-2, caspase 3, 8, and 9 mRNA levels in MDA-MB-231 and MCF-7 cells. Individual gene expression levels were normalized by using GAPDH. Values\nindicated with stars are statistically significant different from control group (*p < 0.05).\n\n 7\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n\nCRediT authorship contribution statement [12] G. Fang, A. Zhang, L. Zhu, Q. Wang, F. Sun, B. Tang, Nanocarriers containing\n platinum compounds for combination chemotherapy, Front. Pharmacol. 13 (2022)\n 1050928, https://doi.org/10.3389/fphar.2022.1050928.\n Cigdem Sahin: Writing \u2013 review & editing, Writing \u2013 original draft. [13] Y. Li, B. Liu, C.-X. Xu, L. He, Y.-C. Wan, L.-N. Ji, Z.-W. Mao, Mitochondria-targeted\nDogukan Mutlu: Writing \u2013 review & editing, Writing \u2013 original draft. phosphorescent cyclometalated iridium(III) complexes: synthesis, characterization,\nAhmet Erdem: Writing \u2013 original draft. Rafet Kilincarslan: Writing \u2013 and anticancer properties, J. Biol. Inorg. Chem. 25 (2020) 597\u2013607, https://doi.\n org/10.1007/s00775-020-01783-2.\nreview & editing, Writing \u2013 original draft. Sevki Arslan: Writing \u2013 [14] J.-J. Cao, Y. Zheng, X.-W. Wu, C.-P. Tan, M.-H. Chen, N. Wu, L.-N. Ji, Z.-W. Mao,\noriginal draft. Anticancer cyclometalated iridium(III) complexes with planar ligands:\n mitochondrial DNA damage and metabolism disturbance, J. Med. Chem. 62 (2019)\n 3311\u20133322, https://doi.org/10.1021/acs.jmedchem.8b01704.\nDeclaration of competing interest [15] L. He, K.-N. Wang, Y. Zheng, J.-J. Cao, M.-F. Zhang, C.-P. Tan, L.-N. Ji, Z.-W. Mao,\n Cyclometalated iridium(iii) complexes induce mitochondria-derived paraptotic cell\n The authors declare the following financial interests/personal re- death and inhibit tumor growth in vivo, Dalton Trans. 47 (2018) 6942\u20136953,\n https://doi.org/10.1039/C8DT00783G.\nlationships which may be considered as potential competing interests: [16] Q. Zhao, C. Huang, F. Li, Phosphorescent heavy-metal complexes for bioimaging,\nCigdem Sahin reports financial support was provided by Istanbul Chem. Soc. Rev. 40 (2011) 2508, https://doi.org/10.1039/c0cs00114g.\nMedeniyet University. Sevki Arslan reports financial support was pro- [17] L. Huang, P.-K.-K. Leung, L.-C.-C. Lee, G.-X. Xu, Y.-W. Lam, K.-K.-W. Lo,\n Photofunctional cyclometallated iridium(iii) polypyridine methylsulfone\nvided by Istanbul Medeniyet University. Rafet Kilincarslan reports complexes as sulfhydryl-specific reagents for bioconjugation, bioimaging and\nfinancial support was provided by Pamukkale University. If there are photocytotoxic applications, Chem. Commun. 58 (2022) 10162\u201310165, https://\nother authors, they declare that they have no known competing financial doi.org/10.1039/D2CC02405E.\n [18] Y. Li, K.-N. Wang, L. He, L.-N. Ji, Z.-W. Mao, Synthesis, photophysical and\ninterests or personal relationships that could have appeared to influence anticancer properties of mitochondria-targeted phosphorescent cyclometalated\nthe work reported in this paper. iridium(III) N-heterocyclic carbene complexes, J. Inorg. Biochem. 205 (2020)\n 110976, https://doi.org/10.1016/j.jinorgbio.2019.110976.\n [19] J.S. Nam, M.-G. Kang, J. Kang, S.-Y. Park, S.J.C. Lee, H.-T. Kim, J.K. Seo, O.-\nAcknowledgements\n H. Kwon, M.H. Lim, H.-W. Rhee, T.-H. Kwon, Endoplasmic reticulum-localized\n iridium(III) complexes as efficient photodynamic therapy agents via protein\n The synthesis and anticancer studies of the iridium complexes modifications, J. Am. Chem. Soc. 138 (2016) 10968\u201310977, https://doi.org/\n 10.1021/jacs.6b05302.\nbearing 2-(1H-benzimidazol-2-yl)quinoline have been supported by the\n [20] Y. Yang, C.-M. Wang, F.-H. Pan, Q.-P. Qin, Q.-J. Xie, Q. Chen, H. Liang, Synthesis\nResearch Fund of Istanbul Medeniyet University (Project Number: F- and biological evaluation of mixed-ligand cyclometalated iridium(iii)\u2013quinoline\nGAP-2022-1813). The synthesis of 2-(1H-benzimidazol-2-yl)quinoline complexes, Dalton Trans. 50 (2021) 16273\u201316280, https://doi.org/10.1039/\nligands part of this paper has been supported by Pamukkale University D1DT02416G.\n [21] X. Liu, Y. Han, X. Ge, Z. Liu, Imidazole and benzimidazole modified half-sandwich\nScientific Research Projects Commission (Project No: 2014FEBE035, iridiumIII N-heterocyclic carbene complexes: synthesis, anticancer application, and\n2016FEBE013 and 2017FEBE042). organelle targeting, Front. Chem. 8 (2020) 182, https://doi.org/10.3389/\n fchem.2020.00182.\n [22] Y.T. Lee, Y.J. Tan, C.E. Oon, Benzimidazole and its derivatives as cancer\nAppendix A. Supplementary material therapeutics: the potential role from traditional to precision medicine, Acta Pharm.\n Sin. B 13 (2023) 478\u2013497, https://doi.org/10.1016/j.apsb.2022.09.010.\n Supplementary data to this article can be found online at https://doi. [23] A. Abdullah Al Awadh, Biomedical applications of selective metal complexes of\n indole, benzimidazole, benzothiazole and benzoxazole: a review (From 2015 to\norg/10.1016/j.bioorg.2024.107706. 2022), Saudi Pharm. J. 31 (2023) (2015) 101698, https://doi.org/10.1016/j.\n jsps.2023.101698.\nReferences [24] T.-R. Chen, Synthesis, structure, and field-effect property of 2-(benzimidazol-2-yl)\n quinoline, Mater. Lett. 59 (2005) 1050\u20131052, https://doi.org/10.1016/j.\n matlet.2004.12.002.\n [1] F. Bray, M. Laversanne, H. Sung, J. Ferlay, R.L. Siegel, I. Soerjomataram, A. Jemal,\n [25] M.A. Bennett, T.-N. Huang, T.W. Matheson, A.K. Smith, S. Ittel, W. Nickerson, 16.\n Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality\n (\u03b76-Hexamethylbenzene)Ruthenium Complexes, in: J.P. Fackler (Ed.), Inorg.\n worldwide for 36 cancers in 185 countries, CA Cancer J. Clin. 74 (2024) (2022)\n Synth., 1st ed., Wiley, 1982, pp. 74\u201378, doi: 10.1002/9780470132524.ch16.\n 229\u2013263, https://doi.org/10.3322/caac.21834.\n [26] A. Erdem, R. K\u0131l\u0131n\u00e7arslan, \u00c7. S\u0327ahin, O. Dayan, N. O\u0308zdemir, Synthesis, thermal,\n [2] R.L. Siegel, K.D. Miller, N.S. Wagle, A. Jemal, Cancer statistics, 2023, CA. Cancer J.\n electrochemical and catalytic behavior toward transfer hydrogenation\n Clin. 73 (2023) 17\u201348, https://doi.org/10.3322/caac.21763.\n investigations of the half-sandwich RuII complexes with 2-(2\u2032-quinolyl)\n [3] F. Mart\u00ednez-Jime\u0301nez, F. Muin\u0303os, I. Sent\u00eds, J. Deu-Pons, I. Reyes-Salazar, C. Arnedo-\n benzimidazoles, J. Mol. Struct. 1220 (2020) 128556, https://doi.org/10.1016/j.\n Pac, L. Mularoni, O. Pich, J. Bonet, H. Kranas, A. Gonzalez-Perez, N. Lopez-Bigas,\n molstruc.2020.128556.\n A compendium of mutational cancer driver genes, Nat. Rev. Cancer 20 (2020)\n [27] O. Dayan, M. Tercan, N. O\u0308zdemir, Syntheses and molecular structures of novel Ru\n 555\u2013572, https://doi.org/10.1038/s41568-020-0290-x.\n (II) complexes with bidentate benzimidazole based ligands and their catalytic\n [4] D.T. Debela, S.G. Muzazu, K.D. Heraro, M.T. Ndalama, B.W. Mesele, D.C. Haile, S.\n efficiency for oxidation of benzyl alcohol, J. Mol. Struct. 1123 (2016) 35\u201343,\n K. Kitui, T. Manyazewal, New approaches and procedures for cancer treatment:\n https://doi.org/10.1016/j.molstruc.2016.06.017.\n current perspectives, 205031212110343, SAGE Open Med. 9 (2021), https://doi.\n [28] S. Sprouse, K.A. King, P.J. Spellane, R.J. Watts, Photophysical effects of metal-\n org/10.1177/20503121211034366.\n carbon.sigma. bonds in ortho-metalated complexes of iridium(III) and rhodium\n [5] U. Anand, A. Dey, A.K.S. Chandel, R. Sanyal, A. Mishra, D.K. Pandey, V. De Falco,\n (III), J. Am. Chem. Soc. 106 (1984) 6647\u20136653, https://doi.org/10.1021/\n A. Upadhyay, R. Kandimalla, A. Chaudhary, J.K. Dhanjal, S. Dewanjee,\n ja00334a031.\n J. Vallamkondu, J.M. Pe\u0301rez De La Lastra, Cancer chemotherapy and beyond:\n [29] T.E. Knight, A.P. Goldstein, M.K. Brennaman, T. Cardolaccia, A. Pandya, J.\n current status, drug candidates, associated risks and progress in targeted\n M. DeSimone, T.J. Meyer, Influence of the fluid-to-film transition on photophysical\n therapeutics, Genes Dis. 10 (2023) 1367\u20131401, https://doi.org/10.1016/j.\n properties of MLCT excited states in a polymerizable dimethacrylate fluid, J. Phys.\n gendis.2022.02.007.\n Chem. B 115 (2011) 64\u201370, https://doi.org/10.1021/jp107077t.\n [6] E.A. Moharram, S.M. El-Sayed, H.A. Ghabbour, H.I. El-Subbagh, Synthesis,\n [30] L. He, J. Qiao, L. Duan, G. Dong, D. Zhang, L. Wang, Y. Qiu, Toward highly efficient\n molecular modeling simulations and anticancer activity of some new Imidazo[2,1-\n solid-state white light-emitting electrochemical cells: blue-green to red emitting\n b]thiazole analogues as EGFR/HER2 and DHFR inhibitors, Bioorg. Chem. 150\n cationic iridium complexes with imidazole-type ancillary ligands, Adv. Funct.\n (2024) 107538, https://doi.org/10.1016/j.bioorg.2024.107538.\n Mater. 19 (2009) 2950\u20132960, https://doi.org/10.1002/adfm.200900723.\n [7] W. Liu, R. Gust, Update on metal N-heterocyclic carbene complexes as potential\n [31] C. Sahin, D. Mutlu, F. Nasirli, G. Mahmoudi, F.I. Zubkov, S. Arslan, N.M. Dogan,\n anti-tumor metallodrugs, Coord. Chem. Rev. 329 (2016) 191\u2013213, https://doi.org/\n New iridium bis-terpyridine complexes: synthesis, characterization, antibiofilm\n 10.1016/j.ccr.2016.09.004.\n and anticancer potentials, Biometals 34 (2021) 701\u2013713, https://doi.org/10.1007/\n [8] S. Ghosh, Cisplatin: the first metal based anticancer drug, Bioorg. Chem. 88 (2019)\n s10534-021-00307-y.\n 102925, https://doi.org/10.1016/j.bioorg.2019.102925.\n [32] D. Mutlu, M. Se\u00e7me, S\u0327. Arslan, Effects of usnic acid on cytotoxicity, colony\n [9] A. Zon\u0301, I. Bednarek, Cisplatin in ovarian cancer treatment\u2014known limitations in\n formation and migration in SK-UT-1 human uterine leiomyosarcoma cells,\n therapy force new solutions, Int. J. Mol. Sci. 24 (2023) 7585, https://doi.org/\n S\u00fcleyman Demirel \u00dcniversitesi Fen Edeb Fak\u00fcltesi Fen Derg 18 (2023) 195\u2013202,\n 10.3390/ijms24087585.\n https://doi.org/10.29233/sdufeffd.1250542.\n[10] X. Yao, K. Panichpisal, N. Kurtzman, K. Nugent, Cisplatin nephrotoxicity: a review,\n [33] M. Secme, D. Mutlu, L. Elmas, S. Arslan, Assessing effects of caffeic acid on\n Am. J. Med. Sci. 334 (2007) 115\u2013124, https://doi.org/10.1097/\n cytotoxicity, apoptosis, invasion, GST enzyme activity, oxidant, antioxidant status\n MAJ.0b013e31812dfe1e.\n and micro-RNA expressions in HCT116 colorectal cancer cells, South Afr. J. Bot.\n[11] J. Zhou, Y. Kang, L. Chen, H. Wang, J. Liu, S. Zeng, L. Yu, The drug-resistance\n 157 (2023) 19\u201326, https://doi.org/10.1016/j.sajb.2023.03.046.\n mechanisms of five platinum-based antitumor agents, Front. Pharmacol. 11 (2020)\n 343, https://doi.org/10.3389/fphar.2020.00343.\n\n\n 8\n\fC. Sahin et al. Bioorganic Chemistry 151 (2024) 107706\n\n[34] R. Liman, A.N. Kursunlu, M. Ozmen, S. Arslan, D. Mutlu, E.S. Istifli, Y. Acikbas, J. Med. Chem. 63 (2020) 4005\u20134021, https://doi.org/10.1021/acs.\n Synthesis of water soluble symmetric and asymmetric pillar[5]arene derivatives: jmedchem.9b02000.\n cytotoxicity, apoptosis and molecular docking studies, J. Mol. Struct. 1265 (2022) [50] B.-B. Chen, N.-L. Pan, J.-X. Liao, M.-Y. Huang, D.-C. Jiang, J.-J. Wang, H.-J. Qiu, J.-\n 133482, https://doi.org/10.1016/j.molstruc.2022.133482. X. Chen, L. Li, J. Sun, Cyclometalated iridium(III) complexes as mitochondria-\n[35] P. Garg, U. De, N. Dehury, H.S. Kim, S. Patra, Cyclometallated imidazo- targeted anticancer and antibacterial agents to induce both autophagy and\n phenanthroline iridium complexes and their anticancer activity, J. Chem. Sci. 130 apoptosis, J. Inorg. Biochem. 219 (2021) 111450, https://doi.org/10.1016/j.\n (2018) 76, https://doi.org/10.1007/s12039-018-1492-6. jinorgbio.2021.111450.\n[36] C. Liu, L. Yu, Y. Liu, F. Li, M. Zhou, NMR study on iridium(III) complexes for [51] J.-J. Lu, X.-R. Ma, K. Xie, M.-R. Chen, B. Huang, R.-T. Li, R.-R. Ye, Lysosome-\n identifying disulfonate substituted bathophenanthroline regio-isomers, Magn. targeted cyclometalated iridium(III) complexes: JMJD inhibition, dual induction of\n Reson. Chem. 49 (2011) 816\u2013823, https://doi.org/10.1002/mrc.2815. apoptosis, and autophagy, Metallomics 14 (2022) mfac068, https://doi.org/\n[37] M. Mart\u00ednez-Alonso, J. Cerda\u0301, C. Momblona, A. Pertega\u0301s, J.M. Junquera- 10.1093/mtomcs/mfac068.\n Herna\u0301ndez, A. Heras, A.M. Rodr\u00edguez, G. Espino, H. Bolink, E. Ort\u00ed, Highly stable [52] Y. Yang, C.-M. Wang, H.-S. Cao, Z. Zhou, Q.-J. Xie, Q.-P. Qin, Q. Chen, Novel 4-/5-\n and efficient light-emitting electrochemical cells based on cationic iridium bromo-8-hydroxyquinoline cyclometalated iridium(III) complexes as highly potent\n complexes bearing arylazole ancillary ligands, Inorg. Chem. 56 (2017) anticancer and bioimaging agents, Inorg. Chem. Commun. 142 (2022) 109609,\n 10298\u201310310, https://doi.org/10.1021/acs.inorgchem.7b01167. https://doi.org/10.1016/j.inoche.2022.109609.\n[38] C. Sahin, M. Sahin, New iridium complexes(III) bearing 2-phenylimidazo[4,5-f] [53] B. Liu, Z. Chen, Y. Li, X.-F. Du, W. Zhang, W. Zhang, Y. Lai, Y. Li, Brominated\n [1,10]-phenanthroline ligand: synthesis, characterization, electrochemical and cyclometalated iridium(iii) complexes for mitochondrial immobilization as\n photoluminescence studies, J. Mol. Struct. 1226 (2021) 129415, https://doi.org/ potential anticancer agents, Dalton Trans. 51 (2022) 7650\u20137657, https://doi.org/\n 10.1016/j.molstruc.2020.129415. 10.1039/D2DT00587E.\n[39] F.O. Garces, R.J. Watts, 1 H and 13 C NMR assignments with coordination-induced [54] F.-X. Wang, M.-H. Chen, Y.-N. Lin, H. Zhang, C.-P. Tan, L.-N. Ji, Z.-W. Mao, Dual\n shift calculations of carbon \u03c3-bonded ortho -metalated rhodium(III) and iridium functions of cyclometalated iridium(III) complexes: anti-metastasis and lysosome-\n (III) complexes, Magn. Reson. Chem. 31 (1993) 529\u2013536, https://doi.org/ damaged photodynamic therapy, ACS Appl. Mater. Interfaces 9 (2017)\n 10.1002/mrc.1260310603. 42471\u201342481, https://doi.org/10.1021/acsami.7b10258.\n[40] R. Cao, J. Jia, X. Ma, M. Zhou, H. Fei, Membrane localized iridium(III) complex [55] L. Liu, J. Chen, M.-M. Wang, Y. Huang, Y. Qian, X. Xue, Z. Su, H.-K. Liu, The\n induces endoplasmic reticulum stress and mitochondria-mediated apoptosis in cyclometalated iridium (III) complex based on 9-Anthracenecarboxylic acid as a\n human cancer cells, J. Med. Chem. 56 (2013) 3636\u20133644, https://doi.org/ lysosomal-targeted anticancer agent, J. Inorg. Biochem. 235 (2022) 111913,\n 10.1021/jm4001665. https://doi.org/10.1016/j.jinorgbio.2022.111913.\n[41] K. Hasan, A.K. Bansal, I.D.W. Samuel, C. Rolda\u0301n-Carmona, H.J. Bolink, E. Zysman- [56] Y. Gu, H. Wen, L. Bai, Y. Zhou, H. Zhang, L. Tian, Y. Zhang, J. Hao, Y. Liu,\n Colman, Tuning the emission of cationic iridium (III) complexes towards the red Exploring anticancer efficiency of mitochondria-targeted cyclometalated iridium\n through methoxy substitution of the cyclometalating ligand, Sci. Rep. 5 (2015) (III) complexes, J. Inorg. Biochem. 212 (2020) 111215, https://doi.org/10.1016/j.\n 12325, https://doi.org/10.1038/srep12325. jinorgbio.2020.111215.\n[42] A. Shafiee, M. Salleh, M. Yahaya, Determination of HOMO and LUMO of [6,6]- [57] E. Beurel, R.S. Jope, The paradoxical pro- and anti-apoptotic actions of GSK3 in the\n phenyl C61-butyric acid 3-ethylthiophene ester and poly (3-octyl-thiophene-2, 5- intrinsic and extrinsic apoptosis signaling pathways, Prog. Neurobiol. 79 (2006)\n diyl) through voltametry characterization, accessed June 25, 2024, Sains Malays. 173\u2013189, https://doi.org/10.1016/j.pneurobio.2006.07.006.\n 40 (2011) 173\u2013176, https://www.semanticscholar.org/paper/Determination-o [58] F. Wachter, M. Grunert, C. Blaj, D.M. Weinstock, I. Jeremias, H. Ehrhardt, Impact\n f-HOMO-and-LUMO-of-%5B6%2C6%5D-phenyl-acid-Shafiee-Salleh/c50f085 of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling, Cell\n 3229859a064f6393f37ef05ad3f7dad56. Commun. Signal 11 (2013) 27, https://doi.org/10.1186/1478-811X-11-27.\n[43] M. Lin, D. Li, X. Wang, C. Luo, Q. Ling, Synthesis and optical properties of white [59] X. Luo, I. Budihardjo, H. Zou, C. Slaughter, X. Wang, Bid, a Bcl2 interacting\n phosphorescent carbazole - iridium copolymers, J. Macromol. Sci. Part A 53 (2016) protein, mediates cytochrome c release from mitochondria in response to\n 222\u2013226, https://doi.org/10.1080/10601325.2016.1143317. activation of cell surface death receptors, Cell 94 (1998) 481\u2013490, https://doi.org/\n[44] S.K. Liew, S. Malagobadan, N.M. Arshad, N.H. Nagoor, A review of the structure- 10.1016/S0092-8674(00)81589-5.\n activity relationship of natural and synthetic antimetastatic compounds, [60] C. Adrain, S.J. Martin, The mitochondrial apoptosome: a killer unleashed by the\n Biomolecules 10 (2020) 138, https://doi.org/10.3390/biom10010138. cytochrome seas, Trends Biochem. Sci. 26 (2001) 390\u2013397, https://doi.org/\n[45] J. Zhao, S. Sun, X. Li, W. Zhang, S. Gou, Enhancing photodynamic therapy efficacy 10.1016/S0968-0004(01)01844-8.\n of upconversion-based nanoparticles conjugated with a long-lived triplet excited [61] H. Shibuya, Y. Kato, M. Saito, T. Isobe, R. Tsuboi, M. Koga, H. Toyota,\n state iridium(III)-naphthalimide complex: toward highly enhanced hypoxia- J. Mizuguchi, Induction of apoptosis and/or necrosis following exposure to\n inducible factor-1, ACS Appl. Bio Mater. 3 (2020) 252\u2013262, https://doi.org/ antitumour agents in a melanoma cell line, probably through modulation of Bcl-2\n 10.1021/acsabm.9b00774. family proteins, Melanoma Res. 13 (2003) 457\u2013464, https://doi.org/10.1097/\n[46] L. Wang, R. Guan, L. Xie, X. Liao, K. Xiong, T.W. Rees, Y. Chen, L. Ji, H. Chao, An 00008390-200310000-00004.\n ER-targeting iridium(III) complex that induces immunogenic cell death in non- [62] C. Artus, H. Boujrad, A. Bouharrour, M.-N. Brunelle, S. Hoos, V.J. Yuste,\n small-cell lung cancer, Angew. Chem. Int. Ed. 60 (2021) 4657\u20134665, https://doi. P. Lenormand, J.-C. Rousselle, A. Namane, P. England, H.K. Lorenzo, S.A. Susin,\n org/10.1002/anie.202013987. AIF promotes chromatinolysis and caspase-independent programmed necrosis by\n[47] Y. Wu, J. Liu, M. Shao, P. Zhang, S. Song, G. Yang, X. Liu, Z. Liu, Cyclometalated interacting with histone H2AX, EMBO J. 29 (2010) 1585\u20131599, https://doi.org/\n iridium(III) dithioformic acid complexes as mitochondria-targeted imaging and 10.1038/emboj.2010.43.\n anticancer agents, J. Inorg. Biochem. 233 (2022) 111855, https://doi.org/ [63] L. Cabon, P. Gala\u0301n-Malo, A. Bouharrour, L. Delavalle\u0301e, M.-N. Brunelle-Navas, H.\n 10.1016/j.jinorgbio.2022.111855. K. Lorenzo, A. Gross, S.A. Susin, BID regulates AIF-mediated caspase-independent\n[48] L. Tian, Y. Zhang, H. Zhang, Y. Zhou, W. Li, Y. Yuan, J. Hao, L. Yang, Y. Liu, necroptosis by promoting BAX activation, Cell Death Differ. 19 (2012) 245\u2013256,\n Synthesis and evaluation of iridium(III) complexes on antineoplastic activity https://doi.org/10.1038/cdd.2011.91.\n against human gastric carcinoma SGC-7901 cells, J. Biol. Inorg. Chem. 26 (2021) [64] J. Lou, Y. Zhou, Z. Feng, M. Ma, Y. Yao, Y. Wang, Y. Deng, Y. Wu, Caspase-\n 705\u2013714, https://doi.org/10.1007/s00775-021-01895-3. independent regulated necrosis pathways as potential targets in cancer\n[49] A.C. Carrasco, V. Rodr\u00edguez-Fanjul, A. Habtemariam, A.M. Pizarro, Structurally management, Front. Oncol. 10 (2021) 616952, https://doi.org/10.3389/\n strained half-sandwich iridium(III) complexes as highly potent anticancer agents, fonc.2020.616952.\n\n\n\n\n 9\n\f", "pages_extracted": 9, "text_length": 73030}