← Back
Synthesis, characterization and cytotoxic activity of cationic half-sandwich Ru(ii) complexes stabilized by iminophosphorane N,N,S and N,N,Se tridentate ligands
Article
Volume 14, Issue 4, 2024, 82
https://doi.org/10.33263/BRIAC144.082
Half-Sandwich Ru(II) Complexes Bearing 2-(2quinoly)benzimidazoles with Anticancer Activity
Ahmet Erdem 1
1
2
3
*
, Dogukan Mutlu 2
, Rafet Kilincarslan 1
, Osman Dayan 3
, Sevki Arslan 2,*
Department of Chemistry, Pamukkale University, Denizli, Turkey
Department of Biology, Pamukkale University, Denizli, Turkey
Department of Chemistry, Canakkale Onsekiz Mart University, Canakkale, Turkey
Correspondence: sevkia@pau.edu.tr (A.S.);
Scopus Author ID 8684142100
Received: 6.06.2023; Accepted: 7.01.2024; Published: 20.07.2024
Abstract: In this article, cytotoxic and apoptotic properties of previously synthesized and characterized
four different half‐sandwich ruthenium (II) complexes (C1-C4) with 2-(2-quinoly) benzimidazole
frameworks (L1-L5) were described. These Ru (II) complexes (C1-C4) had strong cytotoxic activity
towards the human glioblastoma (U373) cancer cell line with low toxicity to the non-cancerous human
embryonic kidney (HEK293) cell line. Mechanistic studies revealed that all complexes caused apoptosis
induction by activating caspases with upregulation of Bax and downregulation of Bcl-2. Our results
indicate that ruthenium (II) complexes with 2-(2-quinoly) benzimidazole frameworks, especially C1
and C4, had a higher cytotoxic and apoptotic activity in human glioblastoma cells, and they should be
further evaluated in detail for its anticancer properties as a new therapeutical strategy for glioblastoma.
Keywords: 2-(2-quinoly)benzimidazole; half-sandwich Ru(II); piano-stool complex; anticancer;
glioblastoma.
© 2024 by the authors. This article is an open-access article distributed under the terms and conditions of the Creative
Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
1. Introduction
The approach to treating cancer has changed progressively from conventional
chemotherapy to targeted therapies that interfere with crucial signaling pathways within tumors
[1]. Glioblastomas (GBMs) constitute 80% of all central nervous system cancers, with
glioblastoma multiforme being among the most aggressive variations [2]. Treatment strategies
for GBMs are short-lived and have limited effects on overall survival. The current treatment
protocol involves surgical removal followed by a combination of radiotherapy and
chemotherapy [3]. The prognosis of glioblastoma multiforme (GBM), one of the most common
brain neoplasms, is frequently unfavorable. Treatment depends on some factors, such as the
age of the patient and the sensitivity of the tumor to chemotherapy. Moreover, tumors
commonly recur either during or shortly after the initial treatment, resulting in a median
survival period of only 15 months for individuals newly diagnosed with GBM [4].
In the field of inorganic medicinal chemistry research, the design of metal-containing
cancer chemotherapeutic agents is in the first place [5,6]. Besides being interesting as catalysts,
Ruthenium complexes have emerged as promising antitumor or antimetastatic agents [7,8].
Notably, following the first approved ruthenium(III) complexes, NAMI-A, imidazolium[transtetrachloro(1H-imidazole)(dimethylsulfoxide)ruthenate(III)] [9], KP1019, indazolium[transtetrachlorobis(1H-indazole)ruthenate(III)], and IT-139, sodium[trans-tetrachlorobis(1Hhttps://biointerfaceresearch.com/
1 of 13
https://doi.org/10.33263/BRIAC144.082
indazole)ruthenate(III)] (also known as NKP-1339) [10,11] in clinical trials, Ru(II)polypyridyl compound (TLD-1433) has recently entered phase IB clinical trials as a
photodynamic therapy (PDT) agent in the treatment of bladder cancer, as seen in Figure 1 [12].
The reduction of these complexes to the more reactive Ru(II) analogy is thought to result in
effective cytotoxicity in vivo [13]. In addition to these, some important arene-ruthenium(II)
complexes (by the Sadler and the Dyson groups) with antineoplastic/antimetastatic activity
have also been developed (Figure 1) [14]. After the advent of platinum-containing drugs [15],
the tendency of widely applied platinum-based drugs to show undesirable side effects, the
curative properties of ruthenium complexes as therapeutic agents are remarkable today [16].
Figure 1. The most popular Ru(III) and Ru(II) complexes are prodrugs.
They also provide less toxicity than platinum-based complexes due in part to the skill
of ruthenium complexes to mimic the behavior of iron and bind to biocompounds [17]. As a
result of this entire development process, the half-sandwich ruthenium(II) complexes have
been identified and studied as potential therapeutic agents [18,19]. Several factors can
influence the cytotoxic activity of half-sandwich Ru(II) complexes. Cytotoxic activity is
significantly affected by the choice and structure of ligands coordinated to the Ru(II) center.
Different ligands can alter the complex's electronic and steric properties, thereby impacting
their interactions with biological targets like DNA or proteins. The composition and
substituents of the arene ligand can affect cytotoxicity by altering the complex's reactivity. The
complex's overall geometry and steric hindrance can also influence its cytotoxic activity by
affecting the accessibility of the complex to its target.
Additionally, the redox properties of the Ru(II)-half-sandwich complex may affect
cytotoxicity through involvement in redox reactions or the generation of reactive oxygen
species [20-22]. The anticancer activity of half-sandwich Ru(II) complexes is demonstrated
through various mechanisms. These mechanisms consist of cellular uptake, activation, DNA
binding, disruption of DNA structure, production of reactive oxygen species (ROS), and
disruption of cellular processes. Cancer cells take up these complexes via different mechanisms
and subsequently undergo biological activation within the cell. They were binding to DNA,
resulting in structural disruptions and conformational alterations.
Moreover, they produce reactive oxygen species (ROS) in cancer cells. These
complexes can disrupt cellular processes by interacting with proteins and enzymes. The Ru(II)
complex and the type of cancer being treated determine the specific mechanisms of action.
https://biointerfaceresearch.com/
2 of 13
https://doi.org/10.33263/BRIAC144.082
Current research is focused on exploring and improving the anticancer properties of these
complexes [8,23-25].
In contrast to the cyclometalated structural complexes of ruthenium, half-sandwich
Ru(II) complexes are gaining increasing interest due to their high anticancer efficiency [26,27].
The common notation formula of half-sandwich Ru(II) complexes is defined [(η6Ph*)Ru(L^L)Z]X, where Ph* can be the electron-rich phenyl group and its derivatives, L^L is
a different type of chelating ligand, while Z is the out-group and X is designated as the
counterion. Such complexes (a three-legged piano stool structure) are octahedral, and the arene
group occupies the three coordination zones. In structure, each moiety has a specific effect on
anticancer activity, among which the most studied chelating ligands (L^L) [28]. The Ru(II)
complexes with a "piano-stool" structure containing chloride and N-donor ligands generally
have good aqueous solubility with sufficient lipophilicity required to cross the cell membrane.
The arene-type ligands stabilize the oxidation state of ruthenium(II), making Ru(II) complexes
more kinetically unstable compared to ruthenium(III) complexes. In addition, these complexes
can provide hydrogen bonding and -stacking in biological activity [29,30]. N, N-type ligands
containing benzimidazole rings are remarkable for their biological activities, and the ligands in
this study are good representatives of these derivatives. Benzimidazole's chirality, steric, and
electronic aspects can be freely modified in such ligands. Although many efficacies of
ruthenium complexes containing the biologically active and medically necessary
benzimidazole ligand have been investigated [31,32], the availability of metal complexes with
derivatives of the 2-(2-quinolyl)benzimidazole-type ligands remains limited, including the
synthesis and catalytic activity studies of the half-sandwich Ru(II) complexes with 2-(2quinolyl)benzimidazoles by our group [33-38]. Anticancer activity studies of especially 2-(2quinolyl)benzimidazoles-Ru(II) complexes will add a great innovation in this field.
The present study reports on the anticancer efficiencies of ruthenium (II) complexes
containing 2-(2'-quinolyl)benzimidazole (C1-C4) on U373 GBM cells. In a previous study, our
group investigated their transfer hydrogenation activity under open-air conditions [37,38].
Under the conditions studied, the synthesized complexes remain stable both in solution and in
solid phase in the presence of humidity and oxygen. The molecular mechanisms of cancer cell
death induced by metal-containing complexes are not very clear, and in vitro, anticancer
mechanisms of half-sandwich ionic Ru(II) complexes based on benzimidazole-quinoline
ligand and p-cymene group have been rarely reported. Hence, four ruthenium(II) complexes,
C1-C4, with a 2-(2-quinolyl)benzimidazole-based ligand prepared [38], and in vitro, cytotoxic
and apoptotic properties of the complexes have been investigated. We hope our results will
contribute to developing new chemotherapeutic agents.
2. Materials and Methods
2.1. Materials and reagents.
Dimethyl sulfoxide (DMSO, cas no.: 67-68-5) was obtained from Carlo Erba
(Germany). 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, cat no.:
475989-1GM) was purchased from Merck (Germany). Trypsin-EDTA (T4049-100ML),
Dulbecco's Modified Eagle Medium (DMEM, D6429-500ML), and Paclitaxel (cas no.: 3306962-4) were purchased from Sigma-Aldrich (Germany). The Fetal Bovine Serum (FBS, cat no.:
FBS-HI-11A) and Penicillin/streptomycin (cat no.: PS-B)mix were obtained from Capricorn
(Germany). All operations were performed outdoors unless otherwise stated. A series of
https://biointerfaceresearch.com/
3 of 13
https://doi.org/10.33263/BRIAC144.082
ligands (L3-L5, Figure 2) derived from 2-(2-quinolyl)benzimidazole [39,40] (QuBim, L1) and
2-(2-quinolyl)-5,6-dimethylbenzimidazole [41] (QuDmBim, L2) which are an N, N-type
ligands have been synthesized, then the half-sandwich complexes (C1-C4) of Ru(II) with NNtype ligands (QuBim = L1 and the substituted ligands L3-L5 derived from QuBim and
QuDmBim) have been prepared by cleavage of [(η6-p-cymene)Ru(-Cl)]2 dimer according to
the published procedure [37,38] (Figure 2), as well as purification methods of the resulting
compounds and characterization results with methods such as NMR, UV-Vis, FT-IR, elemental
analysis, HRESI-MS/MS and X-ray diffraction are given in the paper published by our group
[37,38]. In the mentioned publications, besides Ru(II)-catalyzed transfer hydrogenation (TH)
of acetophenone to secondary alcohols of a series of half-sandwich Ru(II) complexes, including
those in this study, the thermal and electrochemical properties of some selected complexes
were examined.
Figure 2. Synthesis of the quinoline-based ligands and Ru(II) complexes.
2.2. Cell culture and MTT assay.
In this study, we used human glioblastoma (U373) and embryonic kidney (HEK293)
cell lines obtained from the European Collection of Cell Cultures (ECACC). The cells were
grown in DMEM, supplemented with 10% FBS, and 1% penicillin/streptomycin mix. Cells
were cultured in a 100 mm culture dish at 37C and 5% CO2. Cells were passaged every 2-3
days when confluency reached 70-80%. Cells were plated in a 96-well plate (Costar, Corning,
USA) at a density 2x103 and treated with various concentrations (7.8-125 µM) of compound
dissolved in DMSO (not exceeding 0.5%). After 24h, 10 μL MTT reagent (5 mg/mL) was
added to each well and incubated for 4h. The formazan dye was dissolved in 50 μL DMSO.
The absorbance was measured at 590 nm with a microplate reader (Epoch, BioTek, USA). The
MTT assay was performed as previously described [42]. The study was performed in triplicate,
and cell viability was calculated as a percentage of the control. The obtained data were used to
estimate the EC50 values. Calculations were performed using GraphPad Prism® software v.9
(San Diego, California USA).
2.3. Evaluation of apoptosis by Annexin V-APC/7-AAD staining.
The apoptosis was evaluated using the Annexin V-APC/7-AAD Apoptosis Kit
according to the manufacturer's instructions (Elabscience, USA, cat no.: E-CK-A218) as
previously described [43]. U373 cells were seeded in 6-well plates and treated with compounds,
or they were incubated in a culture medium containing DMSO (v/v) (negative control) and 0.2
https://biointerfaceresearch.com/
4 of 13
https://doi.org/10.33263/BRIAC144.082
mM hydrogen peroxide (positive control). After 24h of incubation, cells were harvested with
Trypsin-EDTA. U373 cells were collected, washed twice with PBS, and finally suspended in
a cold Annexin binding buffer. Cells were stained with 5 μL of Annexin V-APC and 10 μL 7AAD and incubated for 15 minutes in the dark. Finally, 400 μL of Annexin binding buffer was
added to each sample and analyzed using CytoFLEX Flow Cytometer (Beckman Coulter,
USA). CytExpert Software was used to calculate the percentage of viable, early apoptotic, late
apoptotic, and necrotic cells.
2.4. Gene expression analysis by RT-qPCR.
Total RNA isolation was performed using the innuPREP RNA Mini Kit 2.0 (Analytik
Jena, Germany), and the OneScript® Plus cDNA Synthesis Kit (ABM, USA) was used for
cDNA synthesis according to the manufacturer’s protocol. RT-qPCR was performed using
ABM KiloGreen 2X qPCR MasterMix (USA) in an Applied Biosystems™ StepOnePlus™
Real-Time PCR System (Thermo Fisher Scientific Inc., USA). The relative gene expression
levels were normalized to GAPDH, and primer sequences for all genes were acquired from the
NCBI database. For the determination of mRNA levels, the 2−ΔΔCt method was used as
described previously [44]. The data were analyzed using the GeneGlobe Data Analysis Center
(Qiagen) tools. The sequences of primers are presented in Table 1.
Table 1. Sequences of primers used for RT-qPCR.
Gene
GAPDH
Bcl-2
Bax
CASP3
CASP8
CASP9
Sequences
Forward: GTCTCCTCTGACTTCAACAGCG
Reverse: ACCACCCTGTTGCTGTAGCCAA
Forward: ATCGCCCTGTGGATGACTGAGT
Reverse: GCCAGGAGAAATCAAACAGAGGC
Forward: GTCTCCTCTGACTTCAACAGCG
Reverse: ACCACCCTGTTGCTGTAGCCAA
Forward: GGAAGCGAATCAATGGACTCTGG
Reverse: GCATCGACATCTGTACCAGACC
Forward: AGAAGAGGGTCATCCTGGGAGA
Reverse: TCAGGACTTCCTTCAAGGCTGC
Forward: GTTTGAGGACCTTCGACCAGCT
Reverse: CAACGTACCAGGAGCCACTCTT
Accession code
NM_002046
NM_000633
NM_004324
NM_004346
NM_001080125
NM_001229
2.5. Statistical analysis.
GraphPad Prism 9.0 software was used for statistical analyses. The results were
presented as the means±SD of at least three replicates. One-way ANOVA analyzed the
statistical differences between the groups. P-values <0.05 were statistically significant.
3. Results and Discussion
3.1. Cytotoxicity against cancer and normal cell lines.
Cytotoxic effects of C1-C4 were performed using MTT assay as described in the
methods part. Cells were treated with different concentrations (7.8, 15.6, 31.25, 62.5, and 125
µM) of compounds for 24 h. All compounds significantly inhibited the viability of both U373
and HEK293 cells in a dose-dependent manner (Figure 3). The most inhibitory effects were
observed in compounds C1, C3, and C4, which were about 90% in U373 cells after treatment
with 31.25µM of these compounds. Similarly, C1, C3, and C4 cytotoxic effects were observed
in non-cancerous HEK293 cells (80%) in the same concentration. The EC50 values were
calculated as 7.49, 20.78, 3.73, and 2.09 µM for C1, C2, C3, and C4, respectively (Figure 3).
https://biointerfaceresearch.com/
5 of 13
https://doi.org/10.33263/BRIAC144.082
On the other hand, EC50 values were found to be 12.64, 30.15, 7.92, and 3.78, respectively, in
the HEK293 cell line. These results show that all compounds can be effective for U373 cells
at lower doses than non-cancerous HEK293 cells.
(a)
(b)
Figure 3. The cytotoxic effects of compounds against (a) U373; (b) HEK293 cells. PC: Positive control –
paclitaxel (5 nM). Data are mean values of two independent replicates. *P<0.05 compared with the control
group.
3.2. Flow cytometric analysis.
The type of cell death was evaluated in U373 cells using flow cytometry (CytoFLEX,
Beckman Coulter). The results are shown in Figure 4. EC50 compound concentrations were
tested individually (7.49, 20.78, 3.73, and 2.09 µM for C1, C2, C3, and C4, respectively) for
24 h and compared with hydrogen peroxide (0.2 mM). Results showed that C1-C4 significantly
increased the percentage of U373 cells in the early stage of apoptosis (26.30, 43.78, 23.80, and
17.35%, respectively) compared to untreated control cells. Significantly lower percentages of
late apoptotic and necrotic cells were detected. All these results showed that our compounds
caused cell death by inducing apoptosis.
Figure 4. The apoptotic effect of the compounds against human glioblastoma (U373) cells by Annexin-V-APC
assay using a flow cytometer.
https://biointerfaceresearch.com/
6 of 13
https://doi.org/10.33263/BRIAC144.082
3.3. Gene expression analysis.
To investigate the alteration of apoptosis pathways by compounds, a qPCR was used to find
out changes in the expression levels of Bax, Bcl-2, CASP3, CASP8, and CASP9 genes. After 24 h of
incubation, Bax mRNA level was increased by 1.35-, 1.17-, 1.15-, and 1.79-fold in U373 cells (P<0.05)
as a result of C1, C2, C3, and C4 treatment, respectively. Similarly, CASP3 mRNA level was increased
1.80-, 1.77-, 1.19-, and 2.27-fold. After 24 h, CASP8 mRNA level was increased 1-41-, 1.71-, 1.59-,
and 1.57- fold for C1, C2, C3, and C4, respectively. Besides, CASP9 mRNA level was upregulated
2.18-, 2.03-, 1.88-, and 3.39-fold in the U373 cell line (P<0.05). However, C1, C2, C3, and C4
treatment caused a 2.48-, 1.85-, 2.87-, and 1.35-fold decrease in Bcl-2 mRNA levels compared to the
control group (Figure 5).
Figure 5. Effects of compounds on apoptosis-related gene expression levels in U373 cells. *P<0.05 compared
with the control group.
Complexes resulting from the association of metals and heterocyclic ligands are of
particular interest in bioinorganic chemistry because they form model compounds of
metalloproteins. Inorganic drugs, which have become very popular in recent years, constitute
an important part of modern medical drugs. For this reason, the chemical synthesis of Ncoordinated metal-protein complexes has been extensively researched and studied in
coordination chemistry [45]. Ruthenium is preferred because it shows very low cellular toxicity
against healthy cells but is easily absorbed by tumor cells and quickly eliminated from the body
[46]. Moreover, ruthenium is so effective because it exhibits properties similar to iron, has a
good ligand exchange rate, and has a cytotoxic effect considerably lower than platinum [47].
In this regard, cytotoxic and apoptotic properties of previously synthesized and
characterized four different half‐sandwich ruthenium(II) complexes (C1-C4) with 2-(2quinoly)benzimidazole frameworks (L1-L5) were described for the first time in this study. As
can be seen in Figure 3, all tested ruthenium complexes showed better cytotoxicity (lower EC50
values) for U373 than HEK293 cells. C3 and C4 had the highest cytotoxicity with an EC50
value of 3.73 and 2.09 μM for glioblastoma cells, respectively. When the relationship between
structure and cytotoxic activity is examined, the structure that distinguishes the C1-C4
complexes from each other is R groups on the non-coordinating nitrogen and the 5,6-positions
of benzimidazole (Figure 2). In the C1-C4 complexes, R groups on the N and 5,6-position,
respectively, H and H (C1), 2-methylbenzyl and H (C2), benzyl and CH3 (C3), 2-methylbenzyl
and CH3 (C4). While all complexes (C1-C4) showed strong activity against the human
glioblastoma (U373) cancer cell line, it was seen that the C4 complex gave the best efficacy
result. It is known that in Ru(II)(p-cymene) based complexes, it results from the better
https://biointerfaceresearch.com/
7 of 13
https://doi.org/10.33263/BRIAC144.082
hydrophobic interaction of the p-cymene part of the metal complexes with the cell membrane
[48,49]. When we compare the cytotoxicity values of the complexes (C1-C4), the first point
that draws attention is that the C2-C4 complexes are significantly higher than the C1 complex.
This result showed us that the R groups on the non-coordinating nitrogen atom in the
benzimidazole ring in the C2-C4 complexes contribute significantly to the activity, and the
group bound to the benzimidazole structure has a significant role in the activity of the
compound. The presence of methyl groups in benzylic aromatic on nitrogen and the
benzimidazol-5,6-position in the C4 complex, it can be thought that the increase in the
ruthenium-N bond strength as well as the increase in the metal electron density makes a
significant contribution to the activity. It is known and interesting that the activity of antitumor
ruthenium complexes is related to their ability to bind DNA [46,50]. It can be said that Ru
metal, the p-cymene effect [44], and the benzimidazole skeleton [51] play an important role in
the activity together. In a different study, which is an example of these effects,
thiosemicarbazone ruthenium(II) complexes reduced cell proliferation in human ovarian
cancer cells A2780 and the metastatic ovarian cancer cells OVCAR-3 in the dose range of 150 μM and high selectivity [24] and also ruthenium(II) tris-pyrazolylmethane complexes
showed antiproliferative effects on different cancer cell lines [52]. Moreover, Ru(II) complexes
containing N,N-donor different types of ligands showed cytotoxic effects on cancer cells that
were consistent with the results of this study [27,53].
In addition to the effect of p-cymene and benzimidazole skeleton groups in the structure
and the properties of R substituents on the nitrogen atom in benzimidazole skeleton (such as
having a heteroatom, steric, electron withdrawer-donating, straight chain, aromaticity,
chirality) on the anticancer activity, the redox potential between different oxidation steps of the
ruthenium atom in the structure, shows a catalytic effect (especially in redox reactions)
depending on the physiological environment. Biochemical changes in cancerization alter the
physiological environment, allowing the ruthenium complex to activate selectively in
cancerous cells [46]. It can be thought that the ruthenium complex binds to DNA due to the
different ligand types in complex (C1-C4) and pseudo-octahedral geometry [37,38] in the
Ru(II) complexes. As a matter of fact, it is known that ruthenium compounds differently affect
the conformation of DNA than cis-platinum and its derivatives. It is also known that ruthenium
compounds play a role in non-nuclear targets (such as mitochondria and cell surface) on the
antineoplastic activity. for this reason, it offers lower toxicity than clinically used antitumor
Pt(II) compounds, a new mechanism of action, potential to show no cross-resistance [50].
Our experiments showed that the cytotoxic activity of ruthenium complexes toward
U373 cells can be attributed to the effective induction of apoptosis (Figure 4). Flow cytometry
was used to evaluate types of cell deaths, including apoptosis. It is well established that it is a
qualitative, quantitative, and accurate technique for analyzing apoptosis. Our result showed
that ruthenium complexes drove apoptosis cell death in human glioblastoma U373 cells.
It is well-known that the two main apoptotic cell death pathways are extrinsic and
intrinsic. Each pathway needs different caspase enzymes to activate it. Apoptosis triggers the
intrinsic pathway by activating CASP9 in response to cytochrome c release from mitochondria.
As a result, this leads to the activation of effector caspases (3, 6, and 7) [54]. On the other hand,
activation of CASP8 that triggers CASP3 activation is observed in the extrinsic pathway of
apoptosis [55]. We detected Ru(II) complexes that increased the pro-apoptotic mRNA levels
and decreased anti-apoptotic Bcl-2 mRNA levels. Figure 5 showed that 24 h treatment with
compounds caused significant increases in the mRNA expression levels of CASP3 and CASP9
https://biointerfaceresearch.com/
8 of 13
https://doi.org/10.33263/BRIAC144.082
(apoptotic) genes and a significant decrease in Bcl-2 (anti-apoptotic) gene expression.
Treatment of C4 upregulated the expression of Bax, CASP3, and CASP9, which is related to
apoptosis. C4 at a concentration of 2.09 μM increased the expression of CASP9 (3.39-fold)
more so than other complexes (Figure 5). Furthermore, treatment caused an increase in the
Bax/Bcl-2 ratio as well. Moreover, all of the synthesized compounds had increased mRNA
levels of CASP8 (Figure 5). All of these results showed that both intrinsic and extrinsic
pathways of apoptosis were involved in cell death induced by these compounds. The apoptotic
effects of Ruthenium complexes containing bis-benzimidazole derivatives were found in
several distinct human cancer types, such as adenocarcinoma alveolar basal epithelial cells
A549 [56], breast cancer cell MCF7 and colorectal cancer cells Caco-2 [57]. Li et al. [58]
reported that treatment with bis-benzimidazole derivatives inhibited cell proliferation of the
malign melanoma cells A375 and caused the induction of caspase-dependent apoptosis.
Moreover, the TUNEL-DAPI assay was used to evaluate caspase activation. Another
study showed that the Ru(III) complex with 2-aminomethyl benzimidazole (AMBI) inhibits
proliferation in MCF-7 and human colon carcinoma HCT-116 cells. Furthermore, it has been
shown that the AMBI causes apoptosis in both cell lines by percent to 23.1 and 33.1% [59].
These results are consistent with the results of our study.
4. Conclusions
Herein, a series of the half-sandwich ruthenium(II) complexes framed by 2-(2quinoly)benzimidazole were found to have cytotoxic and apoptotic effects at low
concentrations in glioblastoma cancer cell line, and they are more selective for these cells than
for non-cancerous cell line. These complexes showed induction of apoptosis via activation of
caspases with upregulation of Bax and downregulation of Bcl-2. All these results showed the
potential use of ruthenium(II) complexes with 2-(2-quinoly)benzimidazole frameworks as a
new therapeutical strategy for glioblastoma. Further studies will be required to test this
hypothesis.
Funding
This research received no external funding.
Acknowledgments
We acknowledge Pamukkale University Scientific Research Projects Commission (Project No:
2014FBE035, 2016FEBE013 and 2017FEBE042) for support.
Conflicts of Interest
The authors declare no conflict of interest.
References
1.
2.
Tsimberidou, A.-M. Targeted therapy in cancer. Cancer Chemother. Pharmacol. 2015, 76, 1113–1132,
https://doi.org/10.1007/s00280-015-2861-1.
Davis, F.G.; Freels, S.; Grutsch, J.; Barlas, S.; Brem, S. Survival rates in patients with primary malignant
brain tumors stratified by patient age and tumor histological type: an analysis based on Surveillance,
Epidemiology, and End Results (SEER) data, 1973-1991. J. Neurosurg. 1998, 88, 1-10,
http://doi.org/10.3171/jns.1998.88.1.0001.
https://biointerfaceresearch.com/
9 of 13
https://doi.org/10.33263/BRIAC144.082
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Yu, W.-D.; Sun, G.; Li, J.; Xu, J.; Wang, X. Mechanisms and therapeutic potentials of cancer immunotherapy
in combination with radiotherapy and/or chemotherapy. Cancer Lett. 2019, 452, 66-70,
https://doi.org/10.1016/j.canlet.2019.02.048.
Tykocki, T.; Eltayeb, M. Ten-year survival in glioblastoma. A systematic review. J. Clin. Neurosci. 2018,
54, 7-13, https://doi.org/10.1016/j.jocn.2018.05.002.
Pete, S.; Roy, N.; Paira, P. A review on homo multinuclear anticancer Metallotherapuetics. Inorganica Chim.
Acta 2021, 517, 120184, https://doi.org/10.1016/j.ica.2020.120184.
Miranda, V.M. Medicinal inorganic chemistry: an updated review on the status of metallodrugs and
prominent metallodrug candidates. Rev. Inorg. Chem. 2022, 42, 29-52, https://doi.org/10.1515/revic-20200030.
Xu, G.; Li, C.; Chi, C.; Wu, L.; Sun, Y.; Zhao, J.; Xia, X.-H.; Gou, S. A supramolecular photosensitizer
derived from an Arene-Ru(II) complex self-assembly for NIR activated photodynamic and photothermal
therapy. Nat. Commun. 2022, 13, 3064, https://doi.org/10.1038/s41467-022-30721-w.
Lee, S.Y.; Kim, C.Y.; Nam, T.G. Ruthenium Complexes as Anticancer Agents: A Brief History and
Perspectives. Drug Des. Dev. Ther. 2020, 14, 5375-5392, https://doi.org/10.2147/DDDT.S275007.
Nayeem, N.; Contel, M. Exploring the Potential of Metallodrugs as Chemotherapeutics for Triple Negative
Breast Cancer. Chem. Eur. J. 2021, 27, 8891–8917, https://doi.org/10.1002/chem.202100438.
Trondl, R.; Heffeter, P.; Kowol, C.R.; Jakupec, M.A.; Berger, W; Keppler, B.K. NKP-1339, the first
ruthenium-based anticancer drug on the edge to clinical application. Chem. Sci. 2014, 5, 2925–2932,
https://doi.org/10.1039/C3SC53243G.
Singh, A.K.; Kumar, A.; Singh, H.; Sonawane, P.; Pathak, P.; Grishina, M.; Yadav, J.P.; Verma, A.; Kumar,
P. Metal Complexes in Cancer Treatment: Journey So Far. Chem. Biodivers. 2023, 20, e202300061,
https://doi.org/10.1002/cbdv.202300061.
Monro, S.; Colón, K.L.; Yin, H.; Roque III, J.; Konda, P.; Gujar, S.; Thummel, R.P.; Lilge, L.; Cameron,
C.G.; McFarland, S.A. Transition Metal Complexes and Photodynamic Therapy from a Tumor-Centered
Approach: Challenges, Opportunities, and Highlights from the Development of TLD1433. Chem. Rev. 2019,
119, 797–828, https://doi.org/10.1021/acs.chemrev.8b00211.
Clarke, M.J.; Zhu, F.; Frasca, D.R. Non-Platinum Chemotherapeutic Metallopharmaceuticals. Chem. Rev.
1999, 99, 2511-2534, https://doi.org/10.1021/cr9804238.
Zeng, L.; Gupta, P.; Chen, Y.; Wang, E.; Ji, L.; Chao, H.; Chen, Z.-S. The development of anticancer
ruthenium(ii) complexes: from single molecule compounds to nanomaterials. Chem. Soc. Rev. 2017, 46,
5771-5804, https://doi.org/10.1039/c7cs00195a.
Suárez-Moreno, G.V.; Hernández-Romero, D.; García-Barradas, Ó.; Vázquez-Vera, Ó.; Rosete-Luna, S.;
Cruz-Cruz, C.A.; López-Monteon, A.; Carrillo-Ahumada, J.; Morales-Morales, D.; Colorado-Peralta, R.
Second and third-row transition metal compounds containing benzimidazole ligands: An overview of their
anticancer
and
antitumour
activity.
Coord.
Chem.
Rev.
2022,
472,
214790,
https://doi.org/10.1016/j.ccr.2022.214790.
Wheate, N.J. Walker, S.; Craig, G.E.; Oun, R. The status of platinum anticancer drugs in the clinic and in
clinical trials. Dalton Trans. 2010, 39, 8113-8127, https://doi.org/10.1039/c0dt00292e.
Pongratz, M.; Schluga, P.; Jakupec, M.A.; Arion, V.B.; Hartinger, C.G.; Allmaier, G.; Keppler, B.K.
Transferrin binding and transferrin-mediated cellular uptake of the ruthenium coordination compound
KP1019, studied by means of AAS, ESI-MS and CD spectroscopy. J. Anal. At. Spectrom. 2004, 19, 46-51,
https://doi.org/10.1039/B309160K.
Govender, P.; Riedel, T.; Dyson, P.J.; Smith, G.S. Higher generation cationic N,N-ruthenium(II)-ethyleneglycol-derived metallodendrimers: Synthesis, characterization and cytotoxicity. J. Organomet. Chem. 2015,
799–800, 38–44, https://doi.org/10.1016/j.jorganchem.2015.09.003.
Kacsir, I.; Sipos, A.; Major, E., Bajusz, N.; Bényei, A.; Buglyó, P.; Somsák, L.; Kardos, G.; Bai, P.; Bokor,
É. Half-Sandwich Type Platinum-Group Metal Complexes of C-Glucosaminyl Azines: Synthesis and
Antineoplastic
and
Antimicrobial
Activities.
Molecules
2023,
28,
3058,
https://doi.org/10.3390/molecules28073058.
Muralisankar, M.; Dheepika, R.; Haribabu, J.; Balachandran, C.; Aoki, S.; Bhuvanesh, N.S.P.; Nagarajan,
S. Design, Synthesis, DNA/HSA Binding, and Cytotoxic Activity of Half-Sandwich Ru(II)-Arene
Complexes Containing Triarylamine–Thiosemicarbazone Hybrids. ACS Omega 2019, 4, 11712-11723,
https://doi.org/10.1021/acsomega.9b01022.
https://biointerfaceresearch.com/
10 of 13
https://doi.org/10.33263/BRIAC144.082
21. Gilewska, A.; Barszcz, B.; Masternak, J.; Kazimierczuk, K.; Sitkowski, J.; Wietrzyk, J.; Turlej, E.
Similarities and differences in d6 low-spin ruthenium, rhodium and iridium half-sandwich complexes:
synthesis, structure, cytotoxicity and interaction with biological targets. J. Biol. Inorg. Chem. 2019, 24, 591–
606, https://doi.org/10.1007/s00775-019-01665-2.
22. Martínez-De-León, C.G.; Flores Vallejo, R.d.C.; Rodríguez-Álvarez, A.; Villareal, M.L.; Grévy, J.-M.
Synthesis, characterization and cytotoxic activity of cationic half-sandwich Ru(II) complexes stabilized by
minophosphorane N,N,S and N,N,Se tridentate ligands. New J. Chem. 2020, 44, 20676-20687,
https://doi.org/10.1039/D0NJ04958A.
23. Rubio, A.R.; González, R.; Busto, N.; Vaquero, M.; Iglesias, A.L.; Jalón, F.A.; Espino, G.; Rodríguez, A.M.;
García, B.; Manzano, B.R. Anticancer Activity of Half-Sandwich Ru, Rh and Ir Complexes with Chrysin
Derived Ligands: Strong Effect of the Side Chain in the Ligand and Influence of the Metal. Pharmaceutics
2021, 13, 1540, https://doi.org/10.3390/pharmaceutics13101540.
24. Guler, S.; Kayali, H.A.; Sadan, E.O., Sen, B.; Subasi, E. Half-Sandwich Arene Ruthenium(II)
Thiosemicarbazone Complexes: Evaluation of Anticancer Effect on Primary and Metastatic Ovarian Cancer
Cell Lines. Front. Pharmacol. 2022, 13, 882756, https://doi.org/10.3389/fphar.2022.882756.
25. Clavel, C.M.; Păunescu, E.; Nowak-Sliwinska, P.; Griffioen, A.W.; Scopelliti, R.; Dyson, P.J. Modulating
the Anticancer Activity of Ruthenium(II)–Arene Complexes. J. Med. Chem. 2015, 58, 3356-3365,
https://doi.org/10.1021/jm501655t.
26. Rylands, L.-I.; Welsh, A.; Maepa, K.; Stringer, T.; Taylor, D.; Chibale, K.; Smith, G.S. Structure-activity
relationship studies of antiplasmodial cyclometallated ruthenium(II), rhodium(III) and iridium(III)
complexes
of
2-phenylbenzimidazoles.
Eur.
J.
Med.
Chem.
2019,
161,
11-21,
https://doi.org/10.1016/j.ejmech.2018.10.019.
27. Warraich, M.Q.; Ghion, A.; Perdisatt, L.; O’Neill, L.; Casey, A.; O’Connor, C. In vitro cytotoxicity, cellular
uptake, reactive oxygen species and cell cycle arrest studies of novel ruthenium(II) polypyridyl complexes
towards A549 lung cancer cell line. Drug Chem. Toxicol. 2021, 44, 319-329,
https://doi.org/10.1080/01480545.2019.1589492.
28. Konkankit, C.C.; Marker, S.C.; Knopf, K.M.; Wilson, J.J. Anticancer activity of complexes of the third row
transition metals, rhenium, osmium, and iridium. Dalton Trans. 2018, 47, 9934–9974,
https://doi.org/10.1039/C8DT01858H.
29. Das, S.; Sinha, S.; Britto, R.; Somasundaram, K.; Samuelson, A.G. Cytotoxicity of half sandwich
ruthenium(II) complexes with strong hydrogen bond acceptor ligands and their mechanism of action. J.
Inorg. Biochem. 2010, 104, 93-104, https://doi.org/10.1016/j.jinorgbio.2009.09.017.
30. Grgurić-Sipka, S.; Ivanović, I.; Rakić, G.; Todorović, N.; Gligorijević, N.; Radulović, S.; Arion, V.B.;
Keppler, B.K.; Tesić, Ž.L. Ruthenium(II)-arene complexes with functionalized pyridines: Synthesis,
characterization and cytotoxic activity. Eur. J. Med. Chem. 2010, 45, 1051-1058,
https://doi.org/10.1016/j.ejmech.2009.11.055.
31. Kumarasamy, K.; Devendhiran, T.; Asokan, S.M.; Mahendran, R.; Lin, M.-C.; Chien, W.-J.; Ramasamy,
S.K.; Huang, C.-Y.; Synthesis and structural characterization of C,N-benzimidazole based ruthenium(II)
complex with in vitro anticancer activity. Inorg. Chem. Commun. 2023, 152, 110662,
https://doi.org/10.1016/j.inoche.2023.110662.
32. Rida, S.M.; El-Hawash, S.A.M.; Fahmy, H.T.Y.; Hazzaa, A.A.; El-Meligy, M.M.M. Synthesis of novel
benzofuran and related benzimidazole derivatives for evaluation of in vitro anti-HIV-1, anticancer and
antimicrobial activities. Arch. Pharm. Res. 2006, 29, 826-833, https://doi.org/10.1007/bf02973901.
33. Min, J.; Zhang, Q.; Sun, W.; Cheng, Y.; Wang, L. Neutral copper(I) phosphorescent complexes from their
ionic counterparts with 2-(2′-quinolyl)benzimidazole and phosphine mixed ligands. Dalton Trans. 2011, 40,
686–693, https://doi.org/10.1039/C0DT01031F.
34. Li, S.; Zhang, B.; Kühn, F.E. Benzimidazolic complexes of methyltrioxorhenium(VII): Synthesis and
application in catalytic olefin epoxidation. J. Organomet. Chem. 2013, 730, 132–136,
https://doi.org/10.1016/j.jorganchem.2012.11.006.
35. Xia, J.; Zhou, Z.; Li, W.; Zhang, H.-Q.; Redshaw, C.; Sun, W.-H. Synthesis, structure and fluorescent
properties of 2-(1H-benzoimidazol-2-yl)quinolin-8-ol ligands and their zinc complexes. Inorganica Chim.
Acta 2013, 394, 569–575, https://doi.org/10.1016/j.ica.2012.09.012.
36. Zhang, W.-J.; Huang, W.; Liang, T.-L.; Sun, W.-H. Half-Titanocene chlorides 2-(benzimidazol-2yl)quinolin-8-olates: Synthesis, characterization and ethylene (co-)polymerization behavior. Chinese J.
Polym. Sci. 2013, 31, 601–609, https://doi.org/10.1007/s10118-013-1253-4.
https://biointerfaceresearch.com/
11 of 13
https://doi.org/10.33263/BRIAC144.082
37. Dayan, O.; Tercan, M.; Özdemir, N. Syntheses and molecular structures of novel Ru(II) complexes with
bidentate benzimidazole based ligands and their catalytic efficiency for oxidation of benzyl alcohol. J. Mol.
Struct. 2016, 1123, 35–43, https://doi.org/10.1016/j.molstruc.2016.06.017.
38. Erdem, A.; Kılınçarslan, R.; Şahin, Ç.; Dayan, O.; Özdemir, N. Synthesis, thermal, electrochemical and
catalytic behavior toward transfer hydrogenation investigations of the half-sandwich RuII complexes with 2(2′-quinolyl)benzimidazoles.
J.
Mol.
Struct.
2020,
1220,
128556,
https://doi.org/10.1016/j.molstruc.2020.128556.
39. Bennett, M.A.; Huang, T.-N.; Matheson, T.W.; Simith, A.K.; Ittel, S.; Nickerson, W. (η6Hexamethylbenzene)Ruthenium Complexes. In Inorganic Syntheses; Fackler Jr., J.P., Ed.; Wiley, 1982,
Volume 21, 74e78, https://doi.org/10.1002/9780470132524.ch16.
40. Chen, T.-R. Synthesis, structure, and field-effect property of 2-(benzimidazol- 2yl) quinoline. Mater. Lett.
2005, 59, 1050-1052, https://doi.org/10.1016/j.matlet.2004.12.002.
41. Mamedov, V.A.; Saifina, D.F.; Gubaidullin, A.T.; Ganieva, V.R.; Kadyrova, S.F.; Rakov, D.V.; Rizvanov,
I.K.; Sinyashin, O.G. Acid-catalyzed rearrangement of 3-(β-2-aminostyryl)quinoxalin-2(1H)ones-a-new and
efficient method for the synthesis of 2-benzimidazol-2-ylquinolines. Tetrahedron Lett. 2010, 51, 6503-6506,
https://doi.org/10.1016/j.tetlet.2010.10.007.
42. Konus, M.; Çetin, D.; Kızılkan, N.D.; Yılmaz, C.; Fidan, C.; Algso, M.; Kavak, E.; Kıvrak, A.; KurtKızıldoğan, A.; Otur, Ç.; Mutlu, D.; Abdelsalam, A.H.; Arslan, S. Synthesis and biological activity of new
indole based derivatives as potent anticancer, antioxidant and antimicrobial agents. J. Mol. Struct. 2022,
1263, 133168, https://doi.org/10.1016/j.molstruc.2022.133168.
43. Yılmaz, C.; Arslan, S.; Mutlu, D.; Konus, M.; Kayhan, A.; Kurt-Kızıldoğan, A.; Otur, Ç.; Ozok, O.; Kıvrak,
A. Identification of 3-Bromo-1-Ethyl-1H-Indole as a Potent Anticancer Agent with Promising Inhibitory
Effects on GST Isozymes. Anticancer Agents Med. Chem. 2021, 21, 1292-1300,
https://doi.org/10.2174/1871520620666200918111940.
44. Kavak, E.; Mutlu, D.; Ozok, O.; Arslan, S.; Kivrak, A. Design, synthesis and pharmacological evaluation of
novel
Artemisinin-Thymol.
Nat.
Prod.
Res.
2022,
36,
3511-33519,
https://doi.org/10.1080/14786419.2020.1865954.
45. Kasem, K.K.; Hazen, R.; Spaulding, R.M. Electrochemical Studies on Substituted Iron-Hexacyanoiron(III)
Bi-Layered Thin Films at Glassy Carbon Electrode/Electrolyte Interface. Interface Sci. 2002, 10, 261-269,
https://doi.org/10.1023/A:1020848711982.
46. Brabec, V.; Nováková, O. DNA binding mode of ruthenium complexes and relationship to tumor cell
toxicity. Drug Resist. Updates 2006, 9, 111-122, https://doi.org/10.1016/j.drup.2006.05.002.
47. Lashgari, K.; Kritikos, M.; Norrestam, R.; Norrby, T. Bis(terpyridine)ruthenium(II)
bis(hexafluorophosphate)diacetonitrile
solvate.
Acta
Cryst.
1999,
C55,
64-67,
https://doi.org/10.1107/S0108270198011378.
48. Akhter, S.; Rehman, A.; Abidi, S.M.A.; Arjmand, F.; Tabassum, S. Synthesis, structural insights, and
biological screening of DNA targeted Ru(II)(η6-p-cymene) complexes containing bioactive aminobenzothiazole ligand scaffolds. New J. Chem. 2022, 46, 11462-11473, https://doi.org/10.1039/D2NJ00883A.
49. Akhter, S.; Arjmand, F.; Pettinari, C.; Tabassum, S. Ru(II)(ƞ6-p-cymene) Conjugates Loaded onto Graphene
Oxide: An Effective pH-Responsive Anticancer Drug Delivery System. Molecules 2022, 27, 7592,
https://doi.org/10.3390/molecules27217592.
50. Gallori, E.; Vettori, C.; Alessio, E.; Vilchez, F.G.; Vilaplana, R.; Orioli, P.; Casini, A.; Messori, L. DNA as
a Possible Target for Antitumor Ruthenium(III) Complexes: A Spectroscopic and Molecular Biology Study
of the Interactions of Two Representative Antineoplastic Ruthenium(III) Complexes with DNA. Arch.
Biochem. Biophys. 2000, 376, 156-162, https://doi.org/10.1006/abbi.1999.1654.
51. Bansal, Y.; Silakari, O. The therapeutic journey of benzimidazoles: A review. Bioorg. Med. Chem. 2012, 20,
6208-6236, https://doi.org/10.1016/j.bmc.2012.09.013.
52. Cervinka, J.; Gobbo, A.; Biancalana, L.; Markova, L.; Novohradsky, V.; Guelfi, M.; Zacchini, S.;
Kasparkova, J.; Brabec, V.; Marchetti, F. Ruthenium(II)-Tris-pyrazolylmethane Complexes Inhibit Cancer
Cell Growth by Disrupting Mitochondrial Calcium Homeostasi. J. Med. Chem. 2022, 65, 10567-10587,
https://doi.org/10.1021/acs.jmedchem.2c00722.
53. Lenis-Rojas, O.A.; Roma-Rodrigues, C.; Carvalho, B.; Cabezas-Sainz, P.; Fernández Vila, S.; Sánchez, L.;
Baptista, P.V.; Fernandes, A.R.; Royo, B. In Vitro and In Vivo Biological Activity of Ruthenium 1,10Phenanthroline-5,6-dione
Arene
Complexes.
Int.
J.
Mol.
Sci.
2022,
23,
13594,
https://doi.org/10.3390/ijms232113594.
https://biointerfaceresearch.com/
12 of 13
https://doi.org/10.33263/BRIAC144.082
54. Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and
caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32,
https://doi.org/10.1186/1471-2121-14-32.
55. Kominami, K.; Nakabayashi, J.; Nagai, T.; Tsujimura, Y.; Chiba, K.; Kimura, H.; Miyawaki, A.; Sawasaki,
T.; Yokota, H.; Manabe, N.; Sakamaki, K. The molecular mechanism of apoptosis upon caspase-8 activation:
Quantitative experimental validation of a mathematical model. Biochim. Biophys. Acta-Mol. Cell Res. 2012,
1823, 1825-1840, https://doi.org/10.1016/j.bbamcr.2012.07.003.
56. Rogala, P.; Jabłońska-Wawrzycka, A.; Czerwonka, G.; Kazimierczuk, K.; Gałczyńska, K.; Michałkiewicz,
S.; Kalinowska-Tłuścik, J.; Karpiel, M.; Klika, K.D. Synthesis, Characterization and Biological
Investigations of Half-Sandwich Ruthenium(II) Complexes Containing Benzimidazole Moiety. Molecules
2023, 28, 40, https://doi.org/10.3390/molecules28010040.
57. Elsayed, S.A.; Harrypersad, S.; Sahyon, H.A.; El-Magd, M.A. Walsby, C.J. Ruthenium(II)/(III) DMSOBased Complexes of 2-Aminophenyl Benzimidazole with In Vitro and In Vivo Anticancer Activity.
Molecules 2020, 25, 4284, https://doi.org/10.3390/molecules25184284.
58. Li, L.; Wong, Y.-S.; Chen, T.; Fan, C.; Zheng, W. Ruthenium complexes containing bis-benzimidazole
derivatives as a new class of apoptosis inducers. Dalton Trans. 2012, 41, 1138-1141,
https://doi.org/10.1039/c1dt11950h.
59. Sahyon, H.A.; El-Bindary, A.A.; Shoair, A.F.; Abdellatif, A.A. Synthesis and characterization of
ruthenium(III) complex containing 2-aminomethyl benzimidazole, and its anticancer activity of in vitro and
in vivo models. J. Mol. Liq. 2018, 255, 122–134, https://doi.org/10.1016/j.molliq.2018.01.140.
https://biointerfaceresearch.com/
13 of 13