← Back
In Vitro and In Silico Screening of Benzimidazole-Based Ruthenium(II) Complexes as Potent ALK Inhibitor for Cancer Prevention.
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
https://doi.org/10.1007/s12010-023-04799-x
ORIGINAL ARTICLE
Characterization and Validation of a Lyophilized
Loop‑Mediated Isothermal Amplification Method
for the Detection of Esox lucius
Nivedhitha Jothinarayanan1 · Frank Karlsen1 · Lars Eric Roseng1
Accepted: 9 December 2023 / Published online: 28 December 2023
© The Author(s) 2023
Abstract
In many ways, globalization is beneficial, but in one way, it promotes the spread of alien
(invasive) species through international trade and transport. In different habitats, Esox
lucius (northern pike) can be considered a regionally alien species, and this fish tends
to establish a higher density population than desired in fresh water. Early identification
of such invasive species using sensitive and quick methods is important to be able to
take immediate measures and avoid environmental problems. Loop-mediated isothermal
amplification (LAMP) has emerged as the best DNA/RNA detection technique, without any expensive equipment and could be used to detect environmental DNA (eDNA).
However, the reagents for amplification are not stable at ambient temperature for field
applications. Therefore, this work aims to lyophilize the entire reaction mixture as a single microbead, with enzyme, and LAMP primers towards the detection of mitochondrial
cytochrome B (Cyt B), a housekeeping gene in Esox lucius. Analytical and molecular
techniques were performed to characterize and validate the lyophilized beads, respectively. The lyophilized beads were stored at two different temperatures, at 20 °C and 4
°C, and tested for biological activity after different time intervals. The result shows that
lyophilized beads are bioactive for almost 30 days when stored at 20 °C, while beads
at 4 °C did not lose their bioactivity after storage for up to one year. This study will be
particularly useful for conducting on-site LAMP analyses in the field, where resources
for freezing and storage are limited.
Keywords Loop-mediated isothermal amplification · Lyophilization · Freeze-dried beads ·
Esox lucius · Storage · Characterization and validation
* Lars Eric Roseng
lars.roseng@usn.no
Nivedhitha Jothinarayanan
nivedhitha.narayanan@usn.no
Frank Karlsen
frank.karlsen@usn.no
1
Department of Microsystems, University of South-Eastern Norway, Raveien 215, 3184 Borre,
Norway
13
Vol.:(0123456789)
5250
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
Introduction
Invasion by unwanted species will have unexpected and undesirable consequences for ecosystems. The presence of alien species can be monitored and assessed at an early stage
using an environmental DNA (eDNA) detection technique, rather than just being assessed
as an exotic condition [1, 2]. eDNA is a genetic material that is released from species living
in the habitat, into the environment including water, soil, and sediments. Protocols using
eDNA can allow for rapid, cost-effective, and standardized collection of data on species
distribution and relative abundance [3]. The quantitative evaluation of native species living in a habitat can be supported by the collection of background information on the invasive species, such as introduction routes into the habitat and changes in ecosystems. This
provides better information about the total amount of native species and helps to execute
essential procedures [4]. Globally, there is an increasing potential impact with high risk
for the future because the biological invasions occur through routes of expanded trade and
transport [5, 6]. Regarding the assessment of endangered species, the International Union
for Conservation of Nature (IUCN) has expanded the global percentage of threatened species to 51% [7]. Consequently, prevention is more important than treatment. By identifying
the new threats, this can help to guide future research. But it is impossible to perform accurate imaging surveys for invasive species in such water bodies; therefore, environmental
DNA survey would be the best way to explore the presence of unwanted species [8]. Northern Pike (Esox lucius), which is a natural species in some water habitats in south-eastern
parts of Norway, will also be a particularly undesirable species in Norwegian mountain
lakes. The distribution of this species must therefore be carefully identified. An unwanted
spread will largely destroy the local indigenous species such as trout and pearl mussel [9].
Detection of eDNA is an effective and feasible technique to monitor biodiversity and to
assess the presence of different living organisms [10, 11]. In the absence of good tools to
find the target species directly in the aquatic environment, eDNA monitoring is a suitable
method for detecting DNA from species such as fish. The application of eDNA monitoring
is used both in research and in the authorities’ management of aquatic species in freshwater, fjords, and marine ecosystems. Molecular biomarkers are required in eDNA analyses to
ensure specific detection of the relevant target organism. The molecular biology techniques
such as Polymerase chain reaction (PCR) [12], Loop-mediated isothermal amplification
(LAMP) [13], Nucleic acid sequence-based amplification (NASBA) [14], and several other
methods can be used in an eDNA evaluation. In this study, we have used the LAMP technique to analyze the DNA of the target species with a desired gene expression, because
LAMP is an isothermal amplification method and more advantageous than PCR, when the
process is to be performed in an automatic way on a lab-on-a-chip platform, in the field.
The key feature of the LAMP technique is that, it amplifies nucleic acids under isothermal
conditions in the range of 61–65 °C. LAMP is a simple and cost-effective reaction method.
Another notable characteristic of the technique is good specificity and high amplification
efficiency. Loss of activity is prevented, as there is no thermal change during the reaction,
and this is the main reason for higher amplification efficiency. Additionally, in the aspect
of greater specificity, the LAMP method uses four primers to identify the six different segments on the template DNA [13, 15, 16]. In this study, highly specific LAMP primers targeting the mitochondrial Cyt B gene of Northern Pike have been designed and used.
Although LAMP is a potential technique for DNA detection and is a cost-effective
reaction, the reaction mixture consists of buffer ions, enzyme, deoxynucleotide triphosphates (dNTPs), betaine, primers of different concentration, and fluorescent dye, and this
13
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5251
reaction mixture is considered not stable at room temperature. Transport of the LAMP reagents from one place to another in the field involves the maintenance of dry ice as well as
transport costs. A major disadvantage will be the maintenance of the cold chain during the
entire transport and storage [17]. Our study therefore focuses on constructing all necessary
reaction components in a freeze-dried bead form, which is well suited for transport and
storage. Such freeze-dried reagent beads can be easily placed inside a reaction chamber of
lab-on-a-chip platform.
Lyophilization is the best process for preserving biomolecules such as proteins,
enzymes, and pharmaceutical liposomes, including a disaccharide as a key protective
agent. The freeze-drying process consists of two main steps, namely freezing and drying
under vacuum. The drying process itself is further classified into (i) the primary drying
where frozen water is removed and (ii) the secondary drying where unfrozen (bound) water
is removed [18]. At the time of drying, when water molecules evaporate, the tertiary biostructure of the protein will be destroyed, and this is avoided by the adding a sugar as a
non-specific protein stabilizer. Commonly, named disaccharides such as sucrose and trehalose are used as cryoprotectants [19, 20]. In this study, we used trehalose which is a good
glass former that helps to stabilize the biomolecules during and after the freeze-drying.
The important glass transition factor of disaccharides is high in trehalose and acts as a support under higher temperature storage condition. Other additional properties should also be
advantageous such as (i) absence of internal hydrogen bond, (ii) less hygroscopicity, and
(iii) low chemical reactivity. This has been shown in previous studies by experimenting the
stability of DNA modifying enzyme with 0.3 M trehalose compared to other saccharides
such as sucrose, sorbitol, mannitol, and galactitol [21]. Studies have revealed that DNA
damage will be significantly reduced during the freeze-drying process of biomolecules,
although DNA damage could not be avoided during room temperature storage. The damage can still be reduced in the presence of trehalose. The cause of DNA destruction is due
to free radical-mediated oxidation. Stability is maintained based on the residual moisture
content of the sample or on the presence and concentration of a cryoprotectant such as
trehalose [22, 23].
The aim of the study is to determine the bioactivity of lyophilized LAMP reagent beads
after storage for varying periods of time at two different temperatures. Batches of lyophilized LAMP reagents with designed primers and different trehalose concentrations were
prepared, characterized, and stored at 4 °C and 20 °C. The result will provide the necessary
information to develop freeze-dried reagents that can be placed, stored, and used inside
a lab-on-a-chip platform, for the detection of eDNA from different species, in automated
machines in the field. The research paper reveals the properties and stability of lyophilized
LAMP reagents for the detection of Esox lucius DNA.
Materials and Methods
Lamp Reaction Setup for Lyophilization
The warm start LAMP Kit (New England Biolabs, Massachusetts) was employed for the
reaction setup, and the components in the kit were Warm Start LAMP 2X Master mix
and LAMP fluorescent dye. The master mixture is expected to contain 10 mM dNTPs
mix, 8 U Bst DNA polymerase, 20 mM Tris HCl, 50 mM KCl, 0.1 % Tween, 10 mM
gSO4, and fluorescent dye could be FAM/SYBr
(NH4)2SO4, 0.8 M betaine, and 8 mM M
13
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5252
Green for one reaction of amplification. Different concentration of trehalose includes 10
%, 15 %, and 20 % which was incorporated in the LAMP reaction mixture (w/v), containing optimized concentration of primers, enzyme, and cofactor ions that were subjected to the freeze-drying process. The reaction was carried out in 25 μL volume, as
suggested by the warm start manual. All the mixture was prepared inside the laminar
air flow chamber (ESCO Biosafety Cabinet, Nordic safe), to avoid contamination. The
primers used in the reaction are constructed by LAMP designer (PREMIER Biosoft,
USA) and are as follows: TACACCACAGGGCTTGATA; GCATGGGCTGTAACGATA
A; AGGGTGCCAATATCTTTGTGGTTCTCAGCCATCCTACCTG; AGTCGGCAC
AGCCTTAAGCCTGGTCGTCACCTAAGAGA; ATCAGCGTGTGATTGCCA; and
CCGAACTAAGCCAGCCAGat F3, B3, FIP, BIP, Loop F, and Loop B primer region,
respectively [24], and commercially purchased from Eurofins Genomics (Denmark).
Freeze Drying Procedure
The whole process of preparing frozen beads was carried out inside the glove box
(MBraun EasyLab) to maintain the inert state with the aim of limiting contamination.
The prepared LAMP reaction mixture was taken in an electronic pipette (eVol XR)
capable of dispensing 5 μL volume bead in each turn. The beads were dispensed in
cold-conditioned vials, placed in a metal block with a supply of liquid nitrogen. Then,
frozen beads containing vials were transferred into the freeze dryer (Labconco, FreeZone Triad) with preprogrammed segments. The freeze-drying program with different
segments and time duration is shown in Table 1.
Analytical Characterization of Lyophilized Beads
The morphology of the lyophilized beads was observed under scanning electron microscope (SEM) (SEM Hitachi, SU 3500). The accelerated voltage of around 10 to 15 kV
was used for observation at different magnification. To distinguish between the functional groups, Raman spectroscopy (Thermo Fisher, Nicolet iS50) was used for pure trehalose bead and the bead with LAMP reagent and trehalose at different concentration.
The He-Ne laser is used for the Raman spectra measurement.
Table 1 The freeze-drying
program segments followed
for the LAMP reaction mixture
during drying
13
Segment
Ramp (°C/min) Hold (°C) Time (hr) Vacuum (mbar)
Pre-freeze
1
2
3
4
5
6
1
0.5
1
1
1
−55
−10
10
20
25
3
2
1
1
4
~0.002 to 0.003
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5253
Fig. 1 The LAMP mixture beads in different concentrations of trehalose (a) 10 %, (b) 15 %, and (c) 20 %
weight percent
LAMP Lyophilized Bead Validation
The prepared beads were stored at two different temperature conditions, one at room temperature 20 °C and another at 4 °C in a refrigerator. Then, five beads were rehydrated with
24 μL of RNase-free water and tested towards Esox lucius DNA template (1 μL) at different time periods; and the amplification cycle was performed using Applied Biosystems,
StepOnePlus (Thermo Fisher Scientific, USA). The reaction was carried out at 65 °C for
1 h and set with 80 cycles. The amplicons were also quantified by fluorometer (Invitrogen,
Qubit 4 Fluorometer) and viewed in 1 % agarose gel electrophoresis with ladder.
Statistical Analysis
All the data were represented as ± standard error of the mean from n = 5 experiments. The
statistical significance was considered using a sample t-test among each experiment from
the Minitab 21 software. The probability value (p-value) 0.05 was considered statistically
significant.
Results
In this study, the process of making bioactive freeze-dried LAMP beads was developed to
establish knowledge about long-term storage with the desired result. The lyophilized beads
will be used as reagents inside a lab-on-a-chip platform in an automated analysis system.
The purpose is to carry out on-site environmental monitoring of rivers and lakes using
LAMP, and to detect the eDNA from Esox lucius (regionally alien). The specificity and
sensitivity of the designed Esox lucius LAMP primers, which were used in the lyophilized
13
5254
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
beads, have been previously determined [24]. Here, some of the characteristic properties of
the freeze-dried beads were examined. Three trehalose concentrations, 10 %, 15 %, and 20
% (w/v), were used in the LAMP mixture beads (Fig. 1). Several batches of 5 μL lyophilized beads were stored over time, in separate sealed glass ampoules both at room temperature 20 °C and at 4 °C in a refrigerator.
Surface Dimensions and Morphology
A scanning electron microscope was used to observe the objects in the micron to nano level
range. The prepared beads were subjected to SEM observation and their dimension was
marked and surface morphology observed (Fig. 2 (i) and (ii)). The physical shape of the 5
μL beads was found to be round to oval shape, depending on the needle tip and dispensing
time. The dimension of the lyophilized beads was found to be in the range of 1.1 to 1.8 mm
Fig. 2 (i) The dimensions of the 5 μL lyophilized beads (a) 10 % trehalose- LAMP mixture bead, (b) 15 %
trehalose-LAMP mixture beads, and (c) 20 % trehalose-LAMP mixture beads. The dimensions vary slightly
for the beads. (ii) The surface morphology of the trehalose-LAMP mixture beads from lower to higher magnification
13
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5255
among the three trehalose concentration beads (Fig. 2 (i)). The surface nature of the lyophilized LAMP mixture beads was examined at higher magnification, revealing the dense and
porous nature, various nanofiber formations connecting the voids of the beads, as clearly
seen (Fig. 2 (ii)). It was noticed that a trehalose concentration of 10 % in the LAMP mixture beads readily absorbs moisture and shrinks immediately, while the increasing concentration of 15 % and 20 % was more stable when exposed to atmospheric air. In this context,
the shrinkage pattern of the surface is seen for the 10 % trehalose-LAMP mixture bead,
and a dense structural surface with a porous nature is visible for both the 15 % trehaloseLAMP mixture bead and 20 % trehalose-LAMP mixture bead. The freeze-dried LAMP
beads, regardless of the trehalose concentration, appeared similar, yet the surface morphology varied between the different beads, and this was the case both with the same and with
different trehalose concentrations. It was of interest to investigate the possible difference
that could be linked to the morphology of the freeze-dried beads and to the formation of
varieties of networks through glycosidic linkage, based on the difference in concentrations
of the trehalose sugar. It was found that the different structure of the freeze-dried LAMP
beads did not have a significant contribution to the reaction time of the LAMP mixture.
Molecular Vibrations by RAMAN Spectroscopy
Trehalose-water-protein interactions have been previously and extensively studied using
spectroscopic methods. In particular, Raman spectroscopy has been used because of the
advantage of label-free detection in biological samples [25–27]. RAMAN spectra analysis
was therefore performed on different freeze-dried beads; completely pure trehalose beads,
and some of the trehalose-LAMP mixture beads, and the spectra are given (Fig. 3). In the
completely pure trehalose bead, the vibrations in the C-O-C skeletal structure produced
strong C-C bond stretching peaks in the range of 400 to 1800 c m−1, which is considered to
be a fingerprint region of trehalose. Clearly prominent peaks at 529 c m−1, 1105 c m−1, and
1363 cm−1 (Fig. 3 (a)) are also characteristic of trehalose. Addition of enzyme and organic
matter resulted in a change of the intensity of trehalose in the fingerprint region (Fig. 3 (b)
and (c)). The intensity of the shoulder peak in the region around 2900 cm−1, which corresponds to C-H stretching, is different for completely pure trehalose beads and for trehaloseLAMP mixture beads, and this also reinforces the presence of biomolecules. The region
of ~3400 cm−1 indicates O-H symmetric and anti-symmetric stretching because free water
may be present during measurement [28–30]. From these RAMAN spectra, the difference
in the molecular vibration of both completely pure trehalose beads and trehalose-LAMP
mixture beads can be seen. In addition, the literature on Raman spectroscopy describes
that trehalose has an ability to make the protein inflexible, which is an essential factor for
protein stabilization [31]. This has also been observed in our results of trehalose both with
and without biomolecules.
Stability Study of Lyophilized Bead
The trehalose-LAMP mixture beads were stored at room temperature to evaluate the activity of lyophilized reagents at different time intervals and the average Ct values (cycle
threshold) of the amplification is indicated (Fig. 4). Our results reveal that the duration of
the stability of the lyophilized reagents without losing any sensitivity was up to 30 days at
room temperature storage. The bioactivity was completely lost after 30 days and showed
zero Ct for 2 months of storage. The average Ct value for 10 % trehalose-LAMP mixture
13
5256
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
Intensity(a.u)
(c)
(b)
(a)
400 800 1200 1600 2000 2400 2800 3200 3600 4000
Raman Shift (cm-1)
Fig. 3 The Raman spectra for (a) pure trehalose bead, (b) the 15 % trehalose-LAMP mixture bead, and (c)
the 20 % trehalose-LAMP mixture bead
13
5257
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
Fig. 4 Exhibits the Ct values obtained from the 20 °C stored lyophilized LAMP beads at different time
intervals
Table 2 Shows descriptive statistics and sample t-test for trehalose-LAMP mixture beads, stored at room
temperature
Sample
N
Mean
StDev
SE mean
95% CI for μ
Null hypothesis
H0: μ = 0.05
Alternative hypothesis
H1: μ ≠ 0.05
T-value
P-value
(32.35; 68.26)
(30.75; 54.04)
(44.11; 56.98)
(34.21; 56.88)
(39.97; 70.90)
7.77
10.10
21.78
11.14
9.94
0.001
0.001
0.000
0.000
0.001
(29.87; 53.79)
(38.26; 60.09)
(49.39; 75.90)
(43.11; 52.41)
(37.49; 67.77)
9.70
12.49
13.11
28.50
9.64
0.001
0.000
0.000
0.000
0.001
(44.00; 72.60)
(36.52; 66.97)
(52.98; 66.63)
(46.30; 57.89)
(61.39; 76.95)
11.31
9.43
24.32
24.94
24.67
0.000
0.001
0.000
0.000
0.000
(a) 10 % trehalose-LAMP mixture beads
First day
5
50.30 14.46
6.47
Third day
5
42.40 9.38
4.19
Fifth day
5
50.54 5.18
2.32
Seventh day 5
45.54 9.13
4.08
One month
5
55.43 12.46
5.57
(b) 15 % trehalose-LAMP mixture beads
First day
5
41.83 9.63
4.31
Third day
5
49.18 8.79
3.93
Fifth day
5
62.65 10.68
4.77
Seventh day 5
47.76 3.74
1.67
One month
5
52.63 12.19
5.45
(c) 20 % trehalose-LAMP mixture beads
First day
5
58.30 11.52
5.15
Third day
5
51.74 12.26
5.48
Fifth day
5
59.81 5.49
2.46
Seventh day 5
52.10 4.67
2.09
One month
5
69.17 6.26
2.80
μ: population mean of first day; third day; fifth day; seventh day; one month
13
5258
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
bead is 50.3, 42.4, 50.5, 45.5, and 55.4 for storage after the first day, third day, fifth day,
seventh day and one month, respectively. After storage of one month, the average Ct for 15
% trehalose-LAMP mixture bead is slightly less than 10 % trehalose-LAMP mixture beads
and much less than 20 % trehalose-LAMP mixture beads. The 95% confidence interval for
the population mean of the 15 % trehalose-LAMP mixture beads was considerably less in
one month storage, compared to the other two compositions of beads as shown in Table 2
(a), (b), and (c). Only the 15 % trehalose-LAMP mixture beads had a significantly lower
Ct, when stored at room temperature for one month. Although the 10 % trehalose-LAMP
mixture beads showed effective bioactivity over the entire storage period, these beads are
not physically stable at room temperature because they readily absorb moisture and become
hygroscopic. Besides, 15 % and 20 % trehalose-LAMP mixture beads maintain their physical bead shape to a greater extent, even when exposed to atmospheric moisture.
The trehalose-LAMP mixture beads were also refrigerated (4 °C) over time to evaluate
the bioactivity of lyophilized reagents at different time intervals, and the average Ct values
of the amplification were calculated (Fig. 5). We observed that the activity of lyophilized
beads was not lost after one year storage at 4 °C and the statistical significance is shown in
Table 3 (a), (b), and (c) for 10 %, 15 %, and 20 % trehalose-LAMP mixture bead, respectively. Although the 20 % trehalose-LAMP mixture bead has a lower Ct value, our results
showed that these values are not consistent and had a standard error of ± 42. The bioactivity of the 15 % trehalose-LAMP mixture beads was significant after one year of storage
with a lower Ct value.
Quantification and Gel Electrophoresis
The template of Northern Pike (Esox lucius) DNA was quantified both before and after
the amplification reaction and amplicons were seen in 1 % agarose gel (Fig. 6 (a) and (b)).
Before amplification, the Northern Pike DNA concentration was 0.0002 μg/μL and this
concentration increases drastically after amplification with lyophilized LAMP reagent
beads. The results indicate that the number of DNA copies would be slightly reduced on
Fig. 5 The Ct values obtained from the 4 °C stored lyophilized LAMP beads at different time intervals
13
5259
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
Table 3 Shows descriptive statistics and sample t-test for trehalose-LAMP mixture beads, stored at 4 °C
Sample
N
Mean
StDev
SE mean
95% CI for μ
Null hypothesis
H0: μ = 0.05
Alternative hypothesis
H1: μ ≠ 0.05
T-value
P-value
(31.84; 51.49)
(32.62; 67.95)
(26.86; 67.96)
(22.45; 50.40)
(32.43; 53.90)
(35.62; 44.72)
(37.71; 46.39)
(36.81; 68.01)
11.76
7.90
6.40
7.23
11.15
24.50
26.87
9.32
0.000
0.001
0.003
0.002
0.000
0.000
0.000
0.001
(29.24; 52.77)
(31.95; 61.12)
(32.56; 49.81)
(28.89; 61.60)
(33.68; 47.61)
(36.51; 57.33)
(40.92; 58.21)
(10.57; 64.33)
9.66
8.85
13.24
7.67
16.18
12.50
15.90
3.86
0.001
0.001
0.000
0.002
0.000
0.000
0.000
0.018
(34.85; 53.99)
(40.04; 73.60)
(35.78; 67.21)
(36.81; 71.21)
(49.40; 74.51)
(61.60; 71.87)
(71.20; 77.04)
(−21.6; 82.8)
12.87
9.39
9.09
8.71
13.69
36.08
70.42
1.62
0.000
0.001
0.001
0.001
0.000
0.000
0.000
0.180
(a) 10 % trehalose-LAMP mixture beads
First day
5 41.66 7.91
3.54
Third day
5 50.28 14.23 6.36
Fifth day
5 47.41 16.55 7.40
Seventh day
5 36.42 11.25 5.03
One month
5 43.16 8.65
3.87
Three months 5 40.17 3.66
1.64
Six months
5 42.05 3.49
1.56
One year
5 52.41 12.56 5.62
(b) 15 % trehalose-LAMP mixture beads
First day
5 41.00 9.47
4.24
Third day
5 46.53 11.75 5.25
Fifth day
5 41.18 6.95
3.11
Seventh day
5 45.25 13.17 5.89
One month
5 40.65 5.61
2.51
Three months 5 46.92 8.38
3.75
Six months
5 49.57 6.96
3.11
One year
5 37.45 21.65 9.68
(c) 20 % trehalose-LAMP mixture beads
First day
5 44.42 7.71
3.45
Third day
5 56.82 13.51 6.04
Fifth day
5 51.50 12.66 5.66
Seventh day
5 54.01 13.85 6.19
One month
5 61.95 10.11 4.52
Three months 5 66.74 4.13
1.85
Six months
5 74.12 2.35
1.05
One year
5 30.6
42.0
18.8
μ: population mean of first day; third day; fifth day; seventh day; one month; three months; six months; one
year
day seven of storage of LAMP beads at room temperature. The LAMP amplicons were also
observed as smear band in agarose gel electrophoresis together with the 1Kb ladder and
negative control.
Discussion
Early detection of Esox lucius (a regionally alien species) in local habitats is particularly
important to provide guidance and to assess the implementation of measures early as a part
of environmental monitoring. The lyophilized LAMP beads described in this study could
have a significant impact on establishing a better system for real-time on-site environmental
13
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5260
(a)
(b)
Fig. 6 The estimation of DNA concentration (a) quantification of DNA before and after amplification with
15 % trehalose-LAMP reagent bead mixture stored at room temperature, and (b) appearance of smear DNA
band after amplification with lyophilized beads and compared with the negative control and 1 Kb DNA ladder (Marker)
monitoring in the field. The development of lyophilized LAMP assay for the detection of
Esox lucius using a lab-on-a-chip platform in combination with an automatically operated
electronic instrument will enable efficient and rapid environmental monitoring.
LAMP has the properties that make this molecular biological method well suited for
fieldwork studies, and LAMP is likely to be chosen for automatic real-time on-site environmental monitoring. Unlike PCR, where different temperature patterns are required for
DNA amplification to occur, only a constant temperature around 60–65 °C is required for
LAMP. This means that the LAMP process is much better suited than PCR, when a process
for automatic DNA amplification is to be established inside a lab-on-a-chip platform. The
design of the chip, and the automatic control of the amplification process inside the chip
will be easier to establish when only a constant temperature is obliged.
Our results show that lyophilized LAMP reagent beads, containing 15 % by weight of
the disaccharide trehalose, will maintain their bioactivity after storage at 20 °C for one
month and for up to a year after storage at 4 °C. The amount of target DNA is inversely
related to the Ct value and a lower Ct value with efficient amplification implies the required
concentration of template. On the other hand, very excessive concentration of template
DNA affects the efficiency of amplification and results in large range of Ct variation. However, assay-independent factors affecting the Ct values are less in this experiment. The 10
% trehalose-LAMP mixture bead which readily absorbs atmospheric moisture might fail to
protect the entire enzyme assembly and primer sequence while in storage and is reflected
in the insignificance of Ct value. At the same time, higher concentration of 20 % trehalose will form a macromolecular cluster that can interact with itself and be described as a
crowding agent [32]. This can reduce the amplification rate and affects the Ct value. Therefore, the result in this study recommends the optimized concentration of 15 % trehalose in
the LAMP mixture beads, when Northern Pike is to be detected with a significant Ct value.
13
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5261
Previous studies of lyophilized LAMP reagents to detect dengue virus [33] and Leptospira [34] have also reported the stability after different storage conditions. These studies
reported that lyophilized reagents will break the cold chain associated with storage and that
the LAMP reagents bioactivity will be effective over time. The importance of lyophilized
reagents inside lab-on-a-chip consumables will help to overcome issues such as (i) simplifying reagent storage requirements and (ii) minimizing user intervention, thereby paving
the way for sensitive molecular technologies for non-experts. LAMP has characteristics
that make it ideal for field work and is likely to be used in real-time on-site environmental
monitoring.
Earlier reports on the stabilization and modulation of enzymes are based on the ability
of the disaccharide to form hydrogen bonds, and this type of interaction will preferentially
stabilize the enzyme. The size exclusion effect is higher for trehalose, which contributes
to strong stabilization properties [35]. The results of our study indicate that the stabilization property is directly proportional to the concentration of trehalose, and it is beneficial
when the lyophilized beads are to be stored under normal conditions after the freeze-drying
process. We observed that higher concentration of trehalose profoundly influences the efficiency of nucleic acid amplification. Trehalose is an effective disaccharide as a stabilizer,
but it is also an inhibitor of several enzymes as mentioned in the literature [35–37]. When a
20 % by weight of trehalose was used in our LAMP mixture beads, the results also suggest
it can lower efficiency.
The advantage of the proposed lyophilized reagent method in this article is (1) to secure
bioactive LAMP mixture reagents after storage at relatively high temperatures over time
and (2) to reduce the likelihood of contamination by avoiding the need to open the reaction
tube when assays are performed on site in field situation. Our results show that a trehalose concentration of 15 % by weight in the lyophilized LAMP mixture beads will be the
best trehalose concentration. Compared to the 10 % and 20 % trehalose beads, the 15 %
trehalose-LAMP mixture beads will be well suited for both room temperature storage and
efficient bioactivity. Our freeze-dried beads were specially designed with target-specific
LAMP primers for the detection of mitochondrial Cyt B gene in Esox lucius. The use of
such lyophilized beads avoids the errors that can occur when such reaction mixtures are
prepared manually in the field as part of the environmental DNA analysis. In addition, such
lyophilized beads can be used as the LAMP mixture reagents placed inside automated labon-a-chip platforms, without manual handling and can easily replace the PCR-based field
studies, where resources are limited, and when the field samples must be transported back
to the laboratory for analysis.
Conclusions
The results indicate that lyophilized LAMP reaction mixture beads will be bioactive for
almost 30 days, after storage at room temperature, and that the bioactivity of freeze-dried
beads will last longer when stored at lower temperatures. When stored in a refrigerator at
4 °C, the freeze-dried beads were bioactive for one year. This indicates that lyophilized
state LAMP reagents can be placed on a lab-on-a-chip platform and that it is possible to
store ready packaged chips with reagents over time. This is obviously useful information
for the development of automatic systems that independently (without human intervention)
perform LAMP analyses in the field for detection of northern pike. The lyophilized LAMP
beads easily dissolve in RNase-free water and can be readily mixed with the desired DNA
13
5262
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
template for LAMP analyses. Being able to eliminate the maintenance of cold storage conditions during shipping and storage also provides flexibility for field workers to perform
LAMP analyses under field conditions.
Author Contribution NJ—performed experiments, analyzed the data, manuscript preparation and revision.
LR—contributed to experimental design and manuscript correction. FK—experimental design and manuscript correction. All authors read and approved the final manuscript.
Funding Open access funding provided by University Of South-Eastern Norway. We would like to acknowledge “The Ministry of Education and Research (KD) and Norwegian Environment Agency” for the financial
support (Project No: 2700116) and Norwegian Micro- and Nano-Fabrication Facility (Project No: 295864
NORFAB III) for instruments.
Data Availability Not applicable.
Declarations
Ethics Approval Not applicable.
Consent to Participate Not applicable.
Consent for Publication Not applicable.
Competing Interests The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long
as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article
are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons licence and your intended use is not
permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly
from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
References
1. Moyle, P. B., & Light, T. (1996). Biological invasions of fresh water: Empirical rules and assembly
theory. Biological Conservation, 78(1–2), 149–161. https://doi.org/10.1016/0006-3207(96)00024-9
2. Sax, D. F., & Gaines, S. D. (2003). Species diversity: From global decreases to local increases. Trends
in Ecology & Evolution, 18(11), 561–566. https://doi.org/10.1016/S0169-5347(03)00224-6
3. Darling, J. A., & Mahon, A. R. (2011). From molecules to management: Adopting DNA-based methods for monitoring biological invasions in aquatic environments. Environmental Research, 111(7),
978–988. https://doi.org/10.1016/j.envres.2011.02.001
4. Sandvik, H., Hilmo, O., Henriksen, S., Elven, R., Åsen, P. A., Hegre, H., et al. (2020). Alien species in
Norway: Results from quantitative ecological impact assessments. Ecological Solutions and Evidence,
1(1), 1–12. https://doi.org/10.1002/2688-8319.12006
5. Essl, F., Lenzner, B., Bacher, S., Bailey, S., Capinha, C., Daehler, C., et al. (2020). Drivers of future
alien species impacts: An expert-based assessment. Global Change Biology, 26(9), 4880–4893. https://
doi.org/10.1111/gcb.15199
6. Hulme, P. E. (2009). Trade, transport and trouble: Managing invasive species pathways in an era of
globalization. Journal of Applied Ecology, 46(1), 10–18. https://doi.org/10.1111/j.1365-2664.2008.
01600.x
7. IUCN. (2020). IUCN Red List 2017-2020 Report, 2–40. Retrieved from https://nc.iucnredlist.org/
redlist/resources/files/1630480997-IUCN_RED_LIST_QUADRENNIAL_REPORT_2017-2020.pdf
https://www.iucnredlist.org/
13
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
5263
8. Nathan, L. R., Jerde, C. L., Budny, M. L., & Mahon, A. R. (2015). The use of environmental DNA in
invasive species surveillance of the Great Lakes commercial bait trade. Conservation Biology, 29(2),
430–439. https://doi.org/10.1111/cobi.12381
9. Bardal, H. (2019). Small- and large-scale eradication of invasive fish and fish parasites in freshwater
systems in Norway, Oslo. Island invasives: scaling up to meet the challenge, 62, 447–451. Retrieved
from https://www.sprep.org/attachments/Publications/articles/small-large-scale-eradication-invasive-
fish-fish-parasites-freshwater-systems-norway.pdf
10. Ficetola, G. F., Miaud, C., Pompanon, F., & Taberlet, P. (2008). Species detection using environmental
DNA from water samples. Biology Letters, 4(4), 423–425. https://doi.org/10.1098/rsbl.2008.0118
11. Jerde, C. L., Mahon, A. R., Chadderton, W. L., & Lodge, D. M. (2011). “Sight-unseen” detection of
rare aquatic species using environmental DNA. Conservation Letters, 4(2), 150–157. https://doi.org/
10.1111/j.1755-263X.2010.00158.x
12. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., & Arnheim, N. (1985).
Enzymatic amplification of β-globin genomic sequences and restriction site analysis for diagnosis of
sickle cell anemia. Science, 230(4732), 1350–1354. https://doi.org/10.1126/science.2999980
13. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., & Hase, T. (2000).
Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12). https://doi.org/10.
1093/nar/28.12.e63
14. Compton, J. (1991). Nucleic acid sequence-based amplification. Nature Publishing group, 350, 91–92.
15. Mori, Y., Nagamine, K., Tomita, N., & Notomi, T. (2001). Detection of loop-mediated isothermal
amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochemical
and Biophysical Research Communications, 289(1), 150–154. https://doi.org/10.1006/bbrc.2001.5921
16. Nagamine, K., Watanabe, K., Ohtsuka, K., Hase, T., & Notomi, T. (2001). Loop-mediated isothermal amplification reaction using a nondenatured template [1]. Clinical Chemistry, 47(9), 1742–1743.
https://doi.org/10.1093/clinchem/47.9.1742
17. Njiru, Z. K. (2012). Loop-mediated isothermal amplification technology: Towards point of care diagnostics. PLoS Neglected Tropical Diseases, 6(6), 1–4. https://doi.org/10.1371/journal.pntd.0001572
18. Arakawa, T., Prestrelski, S. J., Kenney, W. C., & Carpenter, J. F. (2001). Factors affecting short-term
and long-term stabilities of proteins. Advanced Drug Delivery Reviews, 46, 307–326. https://doi.org/
10.1016/s0169-409x(00)00144-7
19. Wang, W. (2000). Lyophilization and development of solid protein pharmaceuticals. International
Journal of Pharmaceutics, 203. https://doi.org/10.1016/S0378-5173(00)00423-3
20. Crowe, L. M., Reid, D. S., & Crowe, J. H. (1996). Is trehalose special for preserving dry biomaterials?
Biophysical Journal, 71(4), 2087–2093. https://doi.org/10.1016/S0006-3495(96)79407-9
21. Roser, B. (1991). Trehalose drying: A novel replacement for freeze-drying. BioPharm, 4, 47–53.
22. Zhang, M., Oldenhof, H., Sydykov, B., Bigalk, J., Sieme, H., & Wolkers, W. F. (2017). Freeze-drying
of mammalian cells using trehalose: Preservation of DNA integrity. Scientific Reports, 7(1), 1–10.
https://doi.org/10.1038/s41598-017-06542-z
23. James, A. (1988). DNA Damage and Oxygen Radical Toxicity. Science, 240(4857), 1302–9. https://
doi.org/10.1126/science.3287616
24. Jothinarayanan, N., Karlsen, F., & Roseng, L. E. (2023). Comparative evaluation of loop-mediated
isothermal amplification and PCR for detection of Esox lucius housekeeping genes for use in on-site
environmental monitoring. Journal of Fish Biology, 1–9. https://doi.org/10.1111/jfb.15476
25. Diem, M., Miljković, M., Bird, B., Chernenko, T., Schubert, J., Marcsisin, E., et al. (2012). Applications of infrared and Raman microspectroscopy of cells and tissue in medical diagnostics: Present
status and future promises. Spectroscopy (New York), 27(5–6), 463–496. https://doi.org/10.1155/2012/
848360
26. Xu, M., Ermolenkov, V. V., Uversky, V. N., & Lednev, I. K. (2008). Hen egg white lysozyme fibrillation: A deep-UV resonance Raman spectroscopic study. Journal of Biophotonics, 1(3), 215–229.
https://doi.org/10.1002/jbio.200710013
27. Crowe, J. H., Spargo, B. J., & Crowe, L. M. (1987). Preservation of dry liposomes does not require
retention of residual water. Proceedings of the National Academy of Sciences of the United States of
America, 84(6), 1537–1540. https://doi.org/10.1073/pnas.84.6.1537
28. De Gelder, J., De Gussem, K., Vandenabeele, P., & Moens, L. (2007). Reference database of Raman
spectra of biological molecules. Journal of Raman Spectroscopy, 38, 1133–1147. https://doi.org/10.
1002/jrs.1734
29. Movasaghi, Z., Rehman, S., & Rehman, I. (2007). Raman spectroscopy of biological tissues, (July).
https://doi.org/10.1080/05704920701551530
13
5264
Applied Biochemistry and Biotechnology (2024) 196:5249–5264
30. Abazari, A., Chakraborty, N., Hand, S., Aksan, A., & Toner, M. (2014). A Raman microspectroscopy
study of water and trehalose in spin-dried cells. Biophysical Journal, 107(10), 2253–2262. https://doi.
org/10.1016/j.bpj.2014.09.032
31. Chang, L. L., Shepherd, D., Sun, J., Ouellette, D., Grant, K. L., Tang, X. C., & Pikal, M. J. (2005).
Mechanism of protein stabilization by sugars during freeze-drying and storage : Native structure preservation, specific interaction, and/or immobilization in a glassy matrix ? Journal of Pharmaceutical
Sciences, 94(7), 1427–1444. https://doi.org/10.1002/jps.20364
32. Chen, C., Yao, T., Zhang, Q., He, Y., Xu, L., Zheng, M., et al. (2016). Influence of trehalose on human
islet amyloid polypeptide fibrillation and aggregation. RSC Advances, 6, 15240–15246.
33. Kumar, S., Sharma, S., Bhardwaj, N., & Pande, V. (2021). Advanced Lyophilised Loop Mediated
Isothermal Amplification (L-LAMP) based point of care technique for the detection of dengue virus.
Journal Virological Methods, 293. https://doi.org/10.1016/j.jviromet.2021.114168
34. Chen, H. W., Weissenberger, G., & Ching, W. M. (2016). Development of lyophilized loop-mediated
isothermal amplification reagents for the detection of Leptospira. Military Medicine, 181(5), 227–231.
https://doi.org/10.7205/MILMED-D-15-00149
35. Sola-Penna, M., & Meyer-Fernandes, J. R. (1998). Stabilization against thermal inactivation promoted by sugars on enzyme structure and function: Why is trehalose more effective than other sugars?
Archives of Biochemistry and Biophysics, 360(1), 10–14. https://doi.org/10.1006/abbi.1998.0906
36. Sola-Penna, M., Vieyra, A., & Roberto, M. F. (1994). Uncoupling by trehalose of Ca2+ transport
and ATP hydrolysis by the plasma membrane (Ca2++Mg2+) ATPase of kidney tubules. Zeitschrift
fur Naturforschung - Section C Journal of Biosciences, 49(1–2), 141–146. https://doi.org/10.1515/
znc-1994-1-221
37. Sola-Penna, M., Ferreira-Pereira, A., Lemos, A. D. P., & Meyer-Fernandes, J. R. (1997). Carbohydrate
protection of enzyme structure and function against guanidinium chloride treatment depends on the
nature of carbohydrate and enzyme. European Journal of Biochemistry, 248(1), 24–29. https://doi.org/
10.1111/j.1432-1033.1997.00024.x
Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional affiliations.
13