← Back
Ruthenium(II) complexes containing a pendant methanol amidogen induce apoptosis in SGC-7901 cells through a ROS-mediated mitochondrial dysfunction pathway
Cellular and Molecular Life Sciences (2020) 77:3627–3642
https://doi.org/10.1007/s00018-019-03387-9
Cellular and Molecular Life Sciences
ORIGINAL ARTICLE
A long hypoxia‑inducible factor 3 isoform 2 is a transcription activator
that regulates erythropoietin
Jussi‑Pekka Tolonen1,2 · Minna Heikkilä1,2 · Marjo Malinen3 · Hang‑Mao Lee2 · Jorma J. Palvimo4 · Gong‑Hong Wei2 ·
Johanna Myllyharju1,2
Received: 16 April 2019 / Revised: 12 November 2019 / Accepted: 15 November 2019 / Published online: 25 November 2019
© The Author(s) 2019
Abstract
Hypoxia-inducible factor (HIF), an αβ dimer, is the master regulator of oxygen homeostasis with hundreds of hypoxiainducible target genes. Three HIF isoforms differing in the oxygen-sensitive α subunit exist in vertebrates. While HIF-1 and
HIF-2 are known transcription activators, HIF-3 has been considered a negative regulator of the hypoxia response pathway.
However, the human HIF3A mRNA is subject to complex alternative splicing. It was recently shown that the long HIF-3α
variants can form αβ dimers that possess transactivation capacity. Here, we show that overexpression of the long HIF-3α2
variant induces the expression of a subset of genes, including the erythropoietin (EPO) gene, while simultaneous downregulation of all HIF-3α variants by siRNA targeting a shared HIF3A region leads to downregulation of EPO and additional
genes. EPO mRNA and protein levels correlated with HIF3A silencing and HIF-3α2 overexpression. Chromatin immunoprecipitation analyses showed that HIF-3α2 binding associated with canonical hypoxia response elements in the promoter
regions of EPO. Luciferase reporter assays showed that the identified HIF-3α2 chromatin-binding regions were sufficient
to promote transcription by all three HIF-α isoforms. Based on these data, HIF-3α2 is a transcription activator that directly
regulates EPO expression.
Keywords Hypoxia response · Hypoxia-inducible factor 3 isoform · Transcription activator · Erythropoietin · Chromatin
immunoprecipitation · Hypoxia response element
Introduction
Oxygen-dependent organisms have developed elaborate
means to maintain appropriate intracellular oxygen levels
for the physicochemical reactions that occur within cells.
The master regulators of oxygen homeostasis are the heterodimeric hypoxia-inducible factors (HIFs), present in some
form in all metazoan species studied so far [1, 2]. When
intracellular oxygen tension decreases below a typical
* Johanna Myllyharju
johanna.myllyharju@oulu.fi
1
Oulu Center for Cell–Matrix Research, University of Oulu,
PO Box 5400, 90014 Oulu, Finland
2
Biocenter Oulu and Faculty of Biochemistry and Molecular
Medicine, University of Oulu, 90014 Oulu, Finland
3
Department of Environmental and Biological Sciences,
University of Eastern Finland, 80100 Joensuu, Finland
4
Institute of Biomedicine, University of Eastern Finland,
70211 Kuopio, Finland
concentration, the HIFs initiate and control graded mechanisms to reduce oxygen consumption and to increase oxygen
availability via oxygen-dependent regulation of a genetic
hypoxia response pathway [3, 4].
Three HIF-α subunit isoforms (HIF-1α, HIF-2, and
HIF-3α) have been identified in vertebrates, encoded by
three separate genes (HIF1A, EPAS1, and HIF3A), with
HIF3A mRNA being subject to diverse alternative splicing
[5–10]. HIF-1α, HIF-2α, and some HIF-3α variants contain
basic helix–loop–helix–PAS domains, which facilitate heterodimerization with the HIF-β subunit, encoded by the ARNT
gene, and binding to DNA [11]. Towards their C-terminus,
the HIF-α protein also possess an oxygen-dependent degradation domain (ODDD), which accounts for their oxygendependent regulation. HIF-1α and HIF-2α contain two transactivation domains (NTAD and CTAD), whereas the long
HIF3A splicing variants contain only the NTAD [12].
The HIFs bind to specific hypoxia-responsive elements
(HREs) with a canonical core sequence (5′–RCGTG-3′) [13].
According to genome-wide chromatin immunoprecipitation
13
Vol.:(0123456789)
3628
sequencing (ChIP-seq) studies, approximately 40% and 20%
of HREs for HIF–1 and HIF–2, respectively, reside in promoter regions within a 2.5-kb range from transcription initiation sites (TSS) [14]. HIF–1 appears to bind HREs in promoter regions, while HIF-2 binds more distant regions such
as enhancers [15]. Most importantly, however, HIF-1 and
HIF-2 do not compete for the same binding sites [15]. The
HIF-3 αβ dimer has been shown to recognize the canonical
HRE [16], but the genome-wide binding of the human HIF-3
and its consequences have not been characterized.
Erythropoietin (EPO), the main regulator of red blood
cell production, is a classic hypoxia-inducible gene mainly
targeted by HIF-2 [17]. It is produced in the liver during
early development and later in the kidney [18]. A 256-bp
liver inducibility element (LIE) has been identified immediately 3′ to the gene in Hep3B cells, whereas a negative
regulatory element (NRE) lies 4–6 kb upstream of the gene
[19–22]. A kidney inducibility element (KIE) lies even farther upstream (9.5 to 14 kb), regulating EPO transcription in
peritubular interstitial fibroblasts [17, 21]. The single HRE
found in the LIE is crucial for maximal EPO expression
and is probably bound only by HIF-2 in accordance with
HIF-2 binding to enhancers [15, 17, 22–24]. Although some
candidates for the kidney-specific HRE have been identified
in vitro and in vivo, no definite consensus exists [24–26]. Of
note, HIF1A knockdown does not suppress EPO expression
in the three cell lines studied so far, namely, Hep3B, Kelly,
and cortical astrocytes [23, 27].
Studies of the HIF pathway have thus far focused mainly
on HIF-1 and HIF-2, leaving HIF-3 a relatively unknown
regulator of the hypoxia response. Previous experiments
conducted in mice suggested that a short splice variant
of Hif3a, the inhibitory PAS domain containing protein
(IPAS), acts as a dominant negative inhibitor of the hypoxia
response by forming inactive complexes with HIF-1α and
HIF-2α [5–7, 9, 28]. The short human HIF3A splice variant,
HIF-3α4, inhibits the hypoxia response in a similar dominant
negative manner [10, 12, 29]. However, more recent studies
have suggested that each HIF-3α variant mayperform manifestly different roles and that the long HIF-3 variants possess
transactivation activity [9, 12, 30, 31]. Furthermore, we have
previously shown that simultaneous in vitro knockdown of
all human HIF3A splice variants results in the downregulation of several hypoxia-inducible genes including EPO [12].
Similar to other transcription factors with dominant negative and transactivating splice variants, such as the IKAROS
family zinc finger 1 [32], HIF-3 may thus be a hypoxiainducible transcription factor with a dual role.
To test our hypothesis that human HIF-3 can induce the
transcription of certain hypoxia-inducible genes, we carried
out a cDNA microarray screen of hypoxia-dependent HIF-3
target genes in Hep3B cells. Under hypoxia, an overexpression of the long HIF-3α2 splice variant resulted in over
13
J.-P. Tolonen et al.
twofold upregulation of eight genes, including EPO. HIF-3
clearly contributed to EPO signaling as overexpression of
HIF-3α2 in two cell lines capable of endogenous EPO production, namely, Hep3B and the SK-N-AS neuroblastoma
cell line, and siRNA knockdown of all HIF3A variants in
the SK-N-AS cells resulted in significant changes in EPO
mRNA and protein levels that are in line with the hypothesis
that HIF-3 is a transcription activator. Our ChIP data suggest
that HIF-3 binds its target genes via the canonical HRE. The
HIF-3-binding regions are sufficient to drive the transcription of luciferase reporter genes when co-transfected with
one of the HIF-α isoforms and HIF-β. These data indicate
that at least one of the long HIF-3α variants is a transcription activator involved in erythropoietin signaling by binding
directly on EPO and inducing its transcription.
Materials and methods
Cell culture
Hep3B hepatoma cells were cultured in Earle’s minimum
essential medium (Sigma, USA), ChoK1 cells were cultured
in Dulbecco’s minimum essential medium (Biochrom AG,
Germany) with 0.375% sodium bicarbonate (Sigma) and
SK-N-AS neuroblastoma cells were cultured in RPMI 1640
(Gibco, USA). The culture media for Hep3B and ChoK1
cells were supplemented with 0.1 mM non-essential amino
acids (Sigma), 1 mM sodium puryvate (Sigma), 10% fetal
bovine serum (HyClone, USA), 2 mM l-glutamine (Sigma),
and 100 U/ml penicillin with 0.1 mg/ml streptomycin
(Gibco), while the SK-N-AS culture medium was supplemented with 10% fetal bovine serum (Sigma) and 100 U/
ml penicillin with 0.1 mg/ml streptomycin (Gibco). Cell
culture under hypoxic conditions (1% O
2, 5% C
O2, and 94%
N2) was performed in the I nvivo2 Hypoxia Workstation 400
(Ruskinn Technologies, UK) for cDNA microarray studies,
and the Sci-Tive-N (Baker Ruskinn, UK) hypoxia station
for all other experiments. As the Hep3B cells express EPO
and other endogenous human hypoxia-inducible genes, they
were chosen for the ChIP, cDNA microarray and functional
experiments. The ChoK1 cell line was used as a host for the
luciferase reporter assay due to its high transfection rate. The
SK-N-AS cells that also express EPO were used to confirm
results obtained in Hep3B cells.
Expression plasmids and preparation of the HIF‑3α
antibody
The following expression plasmids described previously
were used in this study: pcDNA3.1/Zeo(-)-V5-HisA,
pEGFP-N1, full-length untagged human HIF-1α, HIF-2α,
3629
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
and HIF-β, and untagged as well as C-terminal V5-tagged
human HIF-3α2 [10, 12].
To generate luciferase reporter constructs for HIF-3α2
binding sites identified by ChIP-seq in EPO, angiopoietinlike-4 (ANGPTL4) and Histone Cluster 1 H2B Family Member K (HIST1H2BK) genes, the DNA for the binding sites
was amplified and cloned into the pGL4.75 vector (Promega,
USA). To study the dependency of HIF-1α and HIF-3α2
binding on the canonical HRE sequences (5′-RCGTG-3′),
all such sites found within the HIF-3α2 HIST1H2BK binding site on the forward and reverse strands were mutated to
5′-ATTTA-3′ (denoted mutHIST1H2BK) using the QuickChangeXL II site-directed mutagenesis kit (Stratagene,
USA) according to manufacturer’s instructions. Mutagenesis
primers are listed in Table 1.
To produce the HIF-3α2 antibody used in the qPCRbased ChIP studies, High Five insect cells (Thermo Fisher
Scientific, USA) were infected with an HIF-3α2 expression plasmid containing the FLAG-His tag. The denatured
HIF-3α2 protein was then purified by QIAexpress metal
chelate chromatography (QIAGEN, Germany) according to
manufacturer’s instructions. Polyclonal antisera were produced at Innovagen Ab (Lund, Sweden) by immunizing rabbits with the denaturated recombinant HIF-3α2 protein. The
antisera were tested to exclude cross-reactivity with HIF-1α
and HIF-2α, after which the HIF-3α2 antibody was purified using HiTrap Protein G HP columns (Amersham, USA)
according to manufacturer’s instructions.
cDNA microarray and qPCR analysis
For overexpression, 300 000 Hep3B cells were co-transfected once with either 1000 ng of pcDNA3.1/Zeo(-) or
1000 ng of HIF-3α2 plasmid with 1000 ng of HIF-β plasmid using FuGENE HD (Promega) and cultured for 24 h
in normoxia and then 24 h in 1% hypoxia. For RNA interference, 300,000 cells were transfected twice with HIF3A
siRNA (siGENOME, USA, MQ-010068-03-0005) targeting
all HIF3A splice variants using siPORT NeoFX (Ambion,
USA) at a 24-h interval and cultured under hypoxia for 24 h
after the second transfection. All samples were prepared in
triplicate and pooled for cDNA microarray analysis. RNA
was isolated by E.Z.N.A Total RNA kit I (Promega). cDNA
was prepared using the iScript cDNA Synthesis Kit (BioRad, USA). The microarray was conducted using two Affymetrix Human Genome U133 Plus 2.0 Array chips with an
Affymetrix Gene Chip Scanner 3000 7G (Thermo Fisher
Scientific, USA) in Biocenter Oulu DNA Analysis Core, and
the data were analyzed using the Chipster software (https
://chipster.csc.fi/, version 3.12) [33]. Functional pathway
analyses were carried out by Chipster using hypergeometric test for Gene Ontology (GO) with default settings. The
microarray data have been deposited in the Gene Expression
Omnibus database with accession number GSE128847.
The results of the microarray analysis were verified by
quantitative real-time PCR (qPCR) with gene-specific primers (Table 1) and SsoFast EvaGreen Supermix (Bio-Rad)
with a CFX96 Touch real-time PCR detection system (BioRad). TATA box-binding protein (TBP), or β-actin (ACTB)
and hypoxanthine phosphoribosyltransferase 1 (HPRT1)
mRNA were used as reference genes for Hep3B and SK-NAS cells, respectively.
Chromatin immunoprecipitation (ChIP) followed
by high‑throughput sequencing (ChIP‑seq)
ChIP experiments were performed as described previously
[34]. Briefly, 1.6 × 106 Hep3B cells were co-transfected with
6 000 ng of HIF-3α2-V5 and 4000 ng of HIF-β plasmids,
cultured under normoxic conditions for 24 h and continued 24 h at 1% oxygen prior to ChIP. For the qPCR based
ChIP studies, the control samples were co-transfected with
10,000 ng of pcDNA3.1-V5-HisA. Cells were crosslinked
with 1% (v/v) formaldehyde and harvested for sonication
to an average fragment size of 200–400 bp using Bioruptor UCD-300-TO (Diagenode, USA). The chromatin was
immunoprecipitated for ChIP-seq with V5-tag antibody
(R960-25, Invitrogen, USA) and for qPCR-based ChIP
assays with the HIF3A antibody described above, and normal rabbit IgG (sc-2027, Santa Cruz Biotechnology, USA).
ChIP-seq samples were processed according to Illumina’s
instructions and DNA libraries were sequenced using Illumina HiSeq System (Illumina, USA) in the EMBL Gene
Core Facility (Heidelberg, Germany). The qPCR-based
ChIP results were normalized with respect to input. Fold
changes were calculated using the formula 2−(ΔCt), where
ΔCt is Ct(immunoprecipitated DNA) − Ct(input) and Ct is the cycle at
which the threshold line is crossed. The primers are listed
in Table 1. The ChIP-seq data have been deposited in the
Gene Expression Omnibus database with accession number
GSE129491.
HIF‑3α2 peak calling and Integrative Genomics
Viewer visualization
The original Fastq files were trimmed by ngsShoRT with the
option “lqr_5adpt_tera”. Reads were aligned to hg19 human
genome by Bowtie2. For the functional analyses, peaks
were called by Homer with default parameters. De novo
motifs were discovered by Homer. To visualize HIF-3α2
binding at certain target genes, peaks were called using the
MACS algorithm with input as control. The bedGraph format from MACS was converted to bigwig using the UCSC
pre-compiled utilities bedGraphToBigWig provided with
chromosome sizes. Finally, the bigWigToWig utility was
13
3630
J.-P. Tolonen et al.
Table 1 Sequences of the primers used in cloning, mutagenesis, RNA interference, qPCR analyses, ChIP studies, and luciferase reporter experiments
Gene
Use
Primer ID
Sequence (5′ → 3′)
ACTB
qPCR
qPCR
ChIP-qPCR
ChIP-qPCR
Cloning
Cloning
ChIP-qPCR
ChIP-qPCR
qPCR
qPCR
qPCR
qPCR
ChIP-qPCR
ChIP-qPCR
ChIP-qPCR
ChIP-qPCR
Cloning
Cloning
ChIP-qPCR
ChIP-qPCR
qPCR
qPCR
RNAi
RNAi
RNAi
RNAi
RNAi
qPCR
qPCR
qPCR
qPCR
ChIP-qPCR
ChIP-qPCR
Cloning
Cloning
Mutagenesis
Mutagenesis
Mutagenesis
Mutagenesis
Mutagenesis
Mutagenesis
Mutagenesis
Mutagenesis
qPCR
qPCR
qPCR
qPCR
ChIP-qPCR
ChIP-qPCR
b-ActinFw
b-ActinRv
ANGPTL4_cQ_F
ANGPTL4_cQ_R
ANGPTL4_B_F
ANGPTL4_B_R
EIF5A_cQ_F
EIF5A_cQ_R
Q_HIF2a_F
Q_HIF2a_R
EPO_RT_F
EPO_RT_R
EPO_ctrl_cQ_F
EPO_ctrl_cQ_R
EPO_cQ_F
EPO_cQ_R
EPO-1_F
EPO-1_R
EPOR_cQ_F
EPOR_cQ_R
Q_HIF1a_F
Q_HIF1a_R
siHIF3A_a
siHIF3A_b
siHIF3A_c
siHIF3A_d
siHIF3A_e
Q_HIF3a_all_F
Q_HIF3a_all_R
HIST1H2BK_Q_F
HIST1H2BK_Q_R
HIST1H2BK_cQ_F
HIST1H2BK_cQ_R
HIST1H2BK_R
HIST1H2BK_R
HIST1H2BK_HRE1_F
HIST1H2BK_HRE1_R
HIST1H2BK_HRE2_F
HIST1H2BK_HRE2_R
HIST1H2BK_HRE3_F
HIST1H2BK_HRE3_R
HIST1H2BK_HRE4_F
HIST1H2BK_HRE4_R
hHprt_F
hHprt_R
hPMB6qfor
hPMB6qrev
PSMD5_cQ_F
PSMD5_cQ_R
TGTGGCATCCACGAAACTAC
TCATACTCCTGCTTGCTGATCC
AAGTGTATGAGTGGCAGCCT
AACTTGCACCGATCTCCTCT
GCGAGATCTCACGGTTCGTAGAGGAAGGC
GCGAAGCTTCCCACTCCTGTCCATACCCT
TGGAGATGGGTAGGGTGTGT
GACCAACCAAGCAGCCCTAT
CCCAGATCCACCATTACAT
ACTCCAGCTGTCGCTTCA
CTCCGAACAATCACTGCT
GGTCATCTGTCCCCTGTCCT
GGAAGGCAATTTTGTGTGCG
CCAAGCACCAGAAACTCACC
CCAGTGGAGAGGAAGCTGAT
CTTCCTTCATCCCCACGTCT
GCGGAGCTCGGATTGTGGGAAGGGAGACC
GCGCTCGAGATAGCCGGGGCGCTAAATC
TAGGCAGCGAACACCAGAAG
TCACACACACACACAAGGCT
CTAGCTTTGCAGAATGCTCAG
GTAGTAGCTGCATGATCGTCTG
UAACAGGGCAGUAUCGCUU
CGACAGGAUUGCAGAAGUG
GCAAGAGCAUCCACACCUU
GAACUGCUCUGGACAUAUG
SR312024B, sequence not available
CCCCACGGAGCGGTGCTTCT
AGTCTGCGCAGGTGGCTTGT
TGCTGCTCGTCTCAGGCTCGT
CTCTCCTTGCGGCTGCGCTT
GGGCCCCTAAGCTTTCAACA
GGCTCTTCTGGCCTTGGAAA
GCGGAGCTCCGGCGTCGAGTTAATCTTGT
GCGCTCGAGTCCGGTTTTCAGTCTGGTCC
AAGACGGTCACCGCCATGGTAAATGTCTACGCGCTCAAGCGCC
GGCGCTTGAGCGCGTAGACATTTACCATGGCGGTGACCGTCTT
GCCGTGACCTACACGGAGTAAATCAAGCGCAAGACGGTCAC
GTGACCGTCTTGCGCTTGATTTACTCCGTGTAGGTCACGGC
TGTTGAAGGTGTTCCTGGAGATAAATATCCGGGACGCCGTGACCTACAC
GTGTAGGTCACGGCGTCCCGGATATTTATCTCCAGGAACACCTTCAACA
TGCTCGCCGCGGCGTAAATAAGCGCATTTCTGGCCTCATCTATGAG
CTCATAGATGAGGCCAGAAATGCGCTTATTTACGCCGCGGCGAGCA
CCTGGCGTCGTGATTAGTGAT
AGACGTTCAGTCCTGTCCATAA
AGCGACACCACAAAGAGTTCA
GCTGATGCTCCTGTAAGACTTGA
AATCTTGATCCTGGGCCAGC
GCGCACGTCCCTATTACTCA
ANGPTL4
EIF5A
EPAS1
EPO
(Control)
(Control)
EPOR
HIF1A
HIF3A
HIST1H2BK
HPRT1
PMB6
PSMD5
13
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
3631
Table 1 (continued)
Gene
Use
Primer ID
Sequence (5′ → 3′)
PTX3
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
hPTXqfor
hPTXqrev
hSLC6A14qfor
hSLC6A14qrev
TBP_Q_F
TBP_Q_R
hTMEM27qfor
hTMEM27qrev
CATCTCCTTGCGATTCTGTTTTG
CCATTCCGAGTGCTCCTGA
ACCGTGGTAACTGGTCCAAAA
CGCCTCCACCATTGCTGTAG
GAATATAATCCCAAGCGGTTTG
ACTTCACATCACAGCTCCCC
CTGGTGACTGCCATTCATGCT
CCATCGCTTTGAAGAGGTATTCT
SLC6A14
TBP
TMEM27
used to produce Wig files that were converted to TDF files
for Integrative Genomics Viewer (IGV) visualization. The
HRE location was searched by the “Find Motif” function in
IGV with pattern “RCGTG”.
HIF‑3α overexpression and knockdown experiments
and EPO‑ELISA
For HIF-α overexpression EPO-ELISA experiments,
140,000 Hep3B cells were transfected with 1 200 ng of
either pcDNA3.1-V5-HisA, HIF-3α2-V5, HIF-1α or HIF-2α,
and 1000 ng of HIF-β plasmids, using FuGENE HD. For SKN-AS cells, 250 000 cells were transfected with 900 ng of
either pcDNA3.1-V5-HisA, HIF-3α2-V5, HIF-1α or HIF-2α,
and HIF-β plasmids using FuGENE HD. For knockdown
experiments in the SK-N-AS neuroblastoma cell line, the
cells were seeded at 250,000 cells per well and transfected
with HIF3A siRNA SR312024B (OriGene, USA) twice at
an interval of 24 h using Lipofectamine RNAiMAX (Invitrogen). After the second transfection, the cells were cultured in
1% O2 for 24 h. Before isolating the total RNA as described
above, the medium was collected and stored at –20 °C for
EPO-ELISA. EPO-ELISA was carried out using the Quantikine IVD ELISA kit (R&D Systems, USA) according to
manufacturer’s instructions. The absorbance was measured
by Tecan Infinite m1000 PRO plate reader (Tecan, Austria)
using 450 nm as the primary wavelength and 600 nm as the
reference wavelength.
Dual luciferase reporter assay
45,000 ChoK1 cells were co-transfected once with 200 ng
of wild-type EPO, ANGPTL4, HIST1H2BK, or mutated
HIST1H2BK luciferase reporters with HIF-1α, HIF-2α, or
HIF-3α2-V5 plasmids at one (100 ng) or twoconcentrations
(100 ng and 300 ng) as indicated, with or without 200 ng of
the HIF-β overexpression plasmid. The empty pcDNA3.1
vector was used to balance the amount of transfected DNA.
The pRL-CMV Renilla luciferase reporter was transfected
for normalization at 10 ng. FuGENE HD (Promega) was
used as transfection reagent. The cells were cultured under
normoxic conditions for 24 h. The luciferase protein samples
were prepared using the Dual-Luciferase Reporter Assay
System (Promega) according to manufacturer’s instructions
and analyzed using the Varioskan LUX plate reader (Thermo
Fisher Scientific).
Statistical analysis
Data are presented as means (± SD). Statistical analyses
were carried out using the two-tailed Student’s t test using
GraphPad Prism (version 7.03). Values of p < 0.05 are considered statistically significant, with * or # denoting p < 0.05,
** or ## p < 0.01, and *** or ### p < 0.001.
Results
Identification of HIF‑3 target genes by microarray
analysis
HIF-3α has previously been considered mainly as a dominant inhibitor of the hypoxia response by competitive binding of the other HIF-α subunits [5]. However, more recent
studies have shown that the long human HIF-3 variants
possess transactivation activity [9, 12, 30, 31, 35]. siRNA
knockdown of all human HIF-3α variants simultaneously
results in downregulation of certain hypoxia-responsive
genes such as EPO, GLUT1, and ANGPTL4, and overexpression of long HIF-3α variants that possess the NTAD
under conditions, where HIF-β is not limiting has an inducing effect on the same genes, with HIF-3α2 producing the
most robust induction of EPO expression out of the five long
HIF-3α variants [12]. To explore the potentially dual role
of HIF-3 in the hypoxia response, we carried out a cDNA
microarray screen of HIF-3α2 overexpression and siRNA
knockdown of all HIF3A splice variants in hypoxic Hep3B
cells.
Setting the cut-off point of change in the expression level
of a gene at ≥ 2-fold revealed eight upregulated (Fig. 1a)
13
3632
J.-P. Tolonen et al.
A
B
E
F
C
D
G
Fig. 1 cDNA microarray screen of hypoxia-dependent HIF-3 target
genes. The heatmaps show ≥ 2-fold upregulated (a) and downregulated (b) genes by HIF-3α2 and HIF-β co-overexpression, and downregulated (c) and upregulated (d) genes by HIF3A siRNA treatment
in Hep3B cells incubated for 24 h in 1% hypoxia. The heatmaps are
based on six pooled biological replicates on two microarray chips
and show relative linear expression levels for control and treated cells
as indicated. Darker shades of blue and red indicate higher levels of
expression. e–g Validation of BMP6, PTX3 and SLC6A14 expression levels by qPCR with HIF-3α2 and HIF-β co-overexpression in
Hep3B cells incubated in 1% hypoxia for 24 h. The qPCR data show
upregulation of target genes that is in line with the microarray data.
The mRNA levels are shown relative to TBP mRNA. Data are represented as means (± SD) from three independent experiments, n = 3.
**p < 0.01, two-tailed Student’s t test
and eight downregulated (Fig. 1b) genes by HIF-3α2 and
HIF-β co-overexpression in Hep3B cells incubated in 1%
hypoxia for 24 h. The control cells were transfected with the
empty pcDNA3.1/Zeo(−) vector and HIF-β. The upregulated
genes include EPO, bone morphogenetic protein 6 (BMP6),
pentraxin 3 (PTX3), and solute carrier family 6 member
14 (SLC6A14) among others. In contrast, the eight genes
downregulated by HIF-3α2 overexpression include sperm
autoantigenic protein 17 (SPA17) and frizzled family receptor 6 (FZD6), among others.
13
3633
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
Next, treating Hep3B cells with either control siRNA or
siRNA targeting all HIF3A splice variants and incubating the
cells in 1% hypoxia for 24 h revealed a downregulation of
39 genes with ≥ 2-fold change (Fig. 1c). These genes include
vesicle-associated membrane protein 7 (VAMP7), thioredoxin interacting protein (TXNIP), proteasome subunit type
6 (PSMB6), and angiopoietin-like 3 (ANGPTL3), among others. In comparison, 24 genes were upregulated ≥ 2-fold by
siHIF3A knockdown (Fig. 1d), including tescalcin (TESC),
solute carrier family 7 member 11 (SLC7A11), and eukaryotic translation initiation factor 3, subunit I (EIF3I).
The cDNA microarray data suggest that HIF-3 has both
inductive and inhibitory effects on global gene expression.
Fig. 2 EPO regulation by HIF-3
in two cell lines. EPO mRNA
and protein levels are upregulated by HIF-α overexpression
in Hep3B (a, b) and SK-N-AS
cells (c, d) when co-transfected
with HIF-β. Treating SK-N-AS
cells with siRNA targeting all
HIF3A variants results in statistically significant downregulation of EPO mRNA and protein
levels (e, f). Fold changes are
relative to cells co-transfected
with empty pcDNA3.1-V5HisA vector and HIF-β, or
control siRNA. EPO mRNA
levels are relative to TBP for
Hep3B cells, and ACTB and
HPRT1 for SK-N-AS cells. Data
represent means (± SD) from
three independent experiments,
n = 6–9. *p < 0.05, **p < 0.01,
***p < 0.001, two-tailed Student’s t test
As the microarray analysis setup was designed to provide
an initial screen of the effects of HIF-3 on gene expression, it should only be taken as indicative. To verify the
changes observed by HIF-3α2 and HIF-β co-overexpression on cDNA microarray, the upregulation of a subset
of genes was confirmed by qPCR. HIF-3α2 overexpression produces an upregulation of BMP6 (2.5 (± 0.37)-fold,
Fig. 1e) and PTX3 (1.9 (± 0.13)-fold, Fig. 1f) but not of
SLC6A14 (Fig. 1g). Similarly, EPO expression was validated on mRNA and protein levels (Fig. 2). Of note, EPO
is expressed at a low level in Hep3B cells and thus only
appears on the HIF-3α2 overexpression microarray.
A
B
C
D
E
F
13
3634
J.-P. Tolonen et al.
Finally, functional enrichment analyses were carried out
with Chipster [33]. Setting the cut-off point at 66% upregulation by HIF-3α2 and HIF-β co-overexpression revealed
an upregulation of 59 genes. GO enrichment analyses suggest that HIF-3α2 is involved in DNA replication-dependent
nucleosome assembly, vascular endothelial growth factor
receptor signaling pathway, urogenital system development,
and erythrocyte homeostasis (Table 2). A cut-off point of
downregulation by 40% upon siHIF3A treatment revealed
126 downregulated genes. GO analysis shows enrichment
of genes involved in heterotypic cell–cell adhesion, plasminogen activation, negative regulation of endothelial cell
apoptotic process, blood coagulation, and fibrin clot formation as well as fibrinolysis (Table 3).
The expression of EPO correlates
with the knockdown of HIF3A and overexpression
of HIF‑3α2
As the microarray data indicate upregulation of EPO by
HIF-3α2 overexpression (Fig. 1a), and as we have previously
shown that siRNA knockdown of all HIF3A splice variants
results in downregulation of EPO mRNA by 39–60% and
protein by 28–73% in Hep3B cells [12], we carried out further HIF-3α2 overexpression experiments in Hep3B and
the EPO-producing SK-N-AS neuroblastoma cells, as well
as siHIF3A knockdown experiments in the SK-N-AS cells.
EPO mRNA was upregulated 7- and 5-fold in Hep3B
and SK-N-AS cells, respectively, with HIF-3α2 overexpression (Fig. 2a, c). In comparison, overexpression of HIF-1α
and HIF-2α resulted in 17- and 25-fold upregulation of EPO
mRNA in Hep3B cells, and in 110- and 220-fold upregulation in SK-N-AS cells, respectively (Fig. 2a, c). A 79%
downregulation of EPO mRNA level was observed in SKN-AS cells with siHIF3A treatment (Fig. 2e). It is highly
unlikely that this was due to non-specific knockdown of
HIF1A or HIF2A, as their mRNA levels were unchanged
(Fig. 2e). Of note, previous experiments using siRNA targeting HIF1A mRNA in Hep3B cells, Kelly neuroblastoma
cells, and cortical astrocytes haveshown no effect on EPO
expression [23, 27].
Changes in EPO expression were then analyzed at protein level by ELISA. Overexpression of HIF-3α2, HIF-1α,
or HIF-2α resulted in sevenfold, 160-fold and 250-fold
Table 2 Gene ontology
(GO) functional analysis of
upregulated genes by HIF-3α2
overexpression in Hep3B cells
GO term
p value
Description
GO:0072163
GO:0033189
GO:0006335
GO:0048010
GO:0055093
GO:0000188
GO:0001655
GO:0034101
GO:0001657
GO:0032094
GO:0032094
GO:1901532
0.00042
0.00193
0.00283
0.00295
0.00389
0.00418
0.00458
0.00554
0.00571
0.0061
0.00648
0.00722
Mesonephric epithelium development
Response to vitamin A
DNA replication-dependent nucleosome assembly
Vascular endothelial growth factor receptor signaling pathway
Response to hyperoxemia
Inactivation of MAPK activity
Urogenital system development
Erythrocyte hemostasis
Ureteric bud development
Response to food
Positive regulation of bone mineralization
Regulation of hematopoietic progenitor cell differentiation
Table 3 Gene Ontology
(GO) functional analysis
of downregulated genes by
siHIF3A treatment of Hep3B
cells
GO term
p value
Description
GO:0034116
GO:0045921
GO:0043436
GO:0031639
GO:1902042
0.00019
0.00042
0.00066
0.00079
0.00096
GO:2000352
GO:0072378
GO:0042730
GO:0051592
GO:1900026
0.00115
0.0124
0.00145
0.00152
0.00156
Positive regulation of heterotypic cell–cell adhesion
Positive regulation of exocytosis
Oxoacid metabolic process
Plasminogen activation
Negative regulation of extrinsic apoptotic signaling pathway via
death domain receptors
Negative regulation of endothelial apoptotic process
Blood coagulation, fibrin clot formation
Fibrinolysis
Response to calcium ion
Positive regulation of substrate adhesion-dependent cell spreading
13
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
increases in EPO protein level in SK-N-AS cells, respectively (Fig. 2d). In Hep3B cells, similar treatment resulted in
sixfold, 18-fold and 36-fold changes, respectively (Fig. 2b).
Treating SK-N-AS cells with siRNA targeting all HIF3A
splice variants resulted in downregulation of EPO protein
level by 28% (Fig. 2f), which is in line with previous results
obtained in Hep3B cells [12].
Next, to assess whether HIF3A mRNA is expressed at a
biologically relevant level, we compared the mRNA abundances of the three HIF-α isoforms by qPCR in normoxic
Hep3B cells and Hep3B cells that were incubated in 1%
hypoxia for 24 h. As expected, the HIF3A mRNA is induced
by 73% in hypoxia (Fig. 3a). Previous studies have shown
that this hypoxic induction is HIF-1 dependent [9, 10]. In
both normoxic and hypoxic Hep3B cells, HIF-1α is the predominant HIF-α isoform with a 240–300-fold abundance
over HIF3A mRNA (Fig. 3a). However, hypoxic Hep3B cells
express HIF-3α and HIF-2α mRNA at a 1:2 ratio (Fig. 3a).
The data—especially that of HIF1A expression—are to be
treated with caution as differences in primer efficiencies cannot be excluded.
Finally, to explore whether co-overexpression of HIF-2α
and HIF-3α2 with or without HIF-β alters EPO expression,
we transfected Hep3B cells with the HIF-α and HIF-β overexpression plasmids as indicated and measured EPO mRNA
abundances by qPCR (Fig. 3b). Of note, the pcDNA3.1/
Zeo(−) backbone produces an upregulation of HIF-α mRNA
A
Fig. 3 Hypoxic Hep3B cells express HIF-2α and HIF-3α at considerably lower levels than HIF-1α. a Hep3B cells were incubated in normoxia (pO2 21%) and 1% hypoxia for 24 h before isolation of mRNA
and quantification by qPCR. HIF-1α mRNA is 240 to 300-fold more
abundant than HIF-3α mRNA, while HIF-2α mRNA abundance is
only 2-fold higher than that of HIF-3α in hypoxia. HIF-3α expression is induced by hypoxia. Data are represented as means (± SD)
from three independent experiments, n = 6. **p < 0.01, ***p < 0.001
against HIF3A mRNA abundance in normoxia, #p < 0.05, ###p < 0.001
against HIF3A mRNA abundance in 1% hypoxia, two-tailed Student’s
3635
by a fold of a few hundred, which most likely saturates
EPO expression. No statistically significant changes were
observed in EPO expression with or without HIF-β upon
co-overexpression of HIF-2α and HIF-3α2 (Fig. 3b). Based
on these findings, it is unlikely that HIF-3α2 acts as a dominant inhibitor of HIF-2α in the context of EPO expression.
The long HIF‑3 αβ dimer binds target gene
promoters via the canonical HRE
To analyze HIF-3 binding to its target genes, we performed
ChIP-seq analysis after HIF-3α2 and HIF-β co-overexpression in Hep3B cells. De novo motif analysis of the peaks
shows that the most significant motif for HIF-3α2 enrichment is the canonical HRE core sequence, 5′-RCGTG-3′,
with the R position showing preference for adenine (Fig. 4a).
The motif is shared most significantly by HIF-β. Overall,
the data show that the HIF-3α2 peaks are enriched in the
promoter regions (data not shown, GSE129491).
Next, ChIP-seq shows enrichment for HIF-3α2 in the
promoter-TSS within the 0.4-kb 5′-flanking region of EPO,
and some enrichment 3′ end to intron 1 (Fig. 4b), a region
involved in liver-specific expression [19, 20]. Enrichment
is not evident immediately at 3′ end of EPO on the 256-bp
LIE (Fig. 4b) which has been identified as a crucial site for
HIF-2, but not HIF-1, driven EPO regulation in the liver
[20, 22, 23]. The 5′-flanking enrichment site contains six
B
t test. b Hep3B cells were transfected with the HIF-2α overexpression plasmid together with either the empty pcDNA3.1 vector or
the HIF-3α2 overexpression plasmid, and with or without the HIF-β
overexpression plasmid as indicated, and incubated in 1% hypoxia for
24 h. Co-overexpression of HIF-3α2 does not induce or inhibit EPO
expression upon HIF-2α overexpression. However, co-overexpression
of HIF-β doubles EPO mRNA abundance. Data are represented as
means (± SD) from three independent experiments, n = 3. *p < 0.05,
**p < 0.01, two-tailed Student’s t test
13
3636
J.-P. Tolonen et al.
A
B
C
13
D
E
F
G
H
I
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
◂Fig. 4 HIF-3 binding is associated with the canonical HRE in the
promoter regions of its target genes. a HIF-3α2 ChIP-seq enrichment
signal associates with the canonical HRE sequence with preference
for A at position R. b, c HIF-3α2 enrichment is observed on the EPO
and ANGPTL4 genes near the promoter-TSS, co-localizing with sites
that contain six canonical HRE sequences (5′-RCGTG-3′, included
HREs underlined) on forward and reverse strands as denoted by blue
and red lines, respectively. Interestingly, no HIF-3α2 enrichment
is detected on the LIE immediately 3′ to EPO. HIF-3α2 enrichment
(first track) is shown relative to input (lower track). Samples were
prepared in triplicate and pooled for ChIP. d–i Validation of a subset of HIF-3α2 chromatin-binding enrichment sites by ChIP-qPCR.
ChIP-qPCR by HIF3A and normal rabbit IgG antibodies shows
amplification in the HIF-3α2 enrichment site on five genes, namely
EPO (d), EPOR (f), EIF5A (g), PSMD5 (h), and ANGPTL4 (i), and
no amplification with a control primer set designed to target regions
of EPO where no enrichment is observed (e), n = 3. The ChIP-qPCR
results are normalized with respect to input. *p < 0.05, **p < 0.01,
***p < 0.001, two-tailed Student’s t test
canonical HREs on the reverse strand, showing HIF-3α2
binding mainly across the first four HREs. In contrast, the
LIE contains only a single HRE. Although the ANGPTL4
gene does not show up on the cDNA microarray data, previous studies have shown that its hypoxic induction is HIF-3
dependent [9, 12], and thus, we decided to pursue it further on ChIP-seq. Two chromatin regions of enrichment for
HIF-3α2 are detected near the promoter-TSS of ANGPTL4,
290 bp upstream and 380 bp downstream from the TSS
(Fig. 4c). The downstream HIF-3α2-enriched region contains up to four canonical HREs.
Finally, we validated the ChIP-seq data by ChIP-qPCR
with primer sets designed to span the HIF-3 binding regions.
ChIP-qPCR shows relative enrichment of HIF-3α2 occupancy over IgG using primer sets for EPO [6.0 (± 1.4)fold], EPOR [48.6 (± 13.9)-fold], EIF5A [47.5 (± 2.4)fold], PSMD5 [10.2 (± 2.3)-fold], and ANGPTL4 [7.2
(± 1.0)-fold], and no enrichment over IgG with a primer set
designed to target a region of EPO, where no HIF-3 binding
was observed (Fig. 4d–i).
HIF‑3α2 overexpression may result in frivolous
HRE‑dependent chromatin binding
To further explore the chromatin binding capacity of the
long HIF-3 αβ dimer, we focused on Histone Cluster 1 H2B
Family Member K (HIST1H2BK) as the ChIP-seq data
suggest HIF-3α2 association with this gene. The ChIP-seq
analysis revealed an enrichment of HIF-3α2 occupancy
in the promoter region 440 bp upstream from the TSS of
HIST1H2BK (Fig. 5a). This region contains four canonical
HREs. ChIP-qPCR confirmed HIF-3α2 binding with a 7.7
(± 2.6)-fold relative enrichment over IgG (Fig. 5b).
To validate the activity of the HIST1H2BK regulatory
sequence, we cloned the HIF-3α2-bound genomic region
of HIST1H2BK in front of a luciferase gene in the pGL4.75
3637
vector. The reporter plasmid was co-transfected into ChoK1
cells with either HIF-1α or HIF-3α2 at two concentrations
(100 ng or 300 ng) with HIF-β and the Renilla reporter
for normalization, after which the ChoK1 cells were incubated in normoxia for 24 h. Both HIF-1α and HIF-3α2 cooverexpressed with HIF-β induce the transcription of the
luciferase reporter, with HIF-1α producing higher levels of
luminescence signal in a dose-dependent manner (Fig. 5c).
HIF-3α2 reaches a plateau already at the lower plasmid
concentration (Fig. 5c). To study the HRE-dependency for
HIF-1α and HIF-3α2 binding, we mutated the four HREs
in the HIST1H2BK luciferase reporter to 5′-ATTTA-3′. The
luminescence signal produced by the mutated HIST1H2BK
luciferase reporter with HIF-1α and HIF-3α2 overexpression was reduced by 66% and 69%, respectively, providing
further evidence that the HREs are necessary for maximal
transcription and are the main but not sole determinant of
HIF binding (Fig. 5d).
However, functional studies suggest that the endogenous
HIF-3 αβ dimer may not bind the HIST1H2BK gene. We
quantified the HIST1H2BK mRNA levels in normoxic and
hypoxic Hep3B cells after incubation in 1% hypoxia for
24 h. Hypoxia downregulates HIST1H2BK expression by
25% in Hep3B cells (Fig. 5e). Finally, treating Hep3B cells
with control siRNA or siRNA targeting all HIF3A splice
variants and incubating the cells in 1% hypoxia for 24 h
shows that HIF3A silencing produces an upregulation of
HIST1H2BK by 65% (Fig. 5f). Therefore, it is possible that
some of the HIF-3α2 occupancy observed on ChIP-seq is
a result of overexpression and may not reflect endogenous
function highlighting the importance of validation of the
data at an endogenous level.
Synergistic activity at the EPO promoter
with HIF‑3α2 and HIF‑1α or HIF‑2α
co‑overexpression
In contrast to the HIST1H2BK gene, functional experiments
in the Hep3B and SK-N-AS cell lines suggest that the long
HIF-3 αβ dimer is involved in the regulation of EPO expression, whereas ChIP assays demonstrate that this regulation
is via direct chromatin binding. To validate the activity of
the regulatory sequence in the EPO promoter, we cloned the
HIF-3α2-bound genomic region into the pGL4.75 luciferase
vector. The EPO luciferase reporter was then co-transfected
into ChoK1 cells with one of the HIF-α isoform overexpression plasmids, the Renilla reporter for normalization,
and either the empty pcDNA3.1/Zeo(−) vector or the HIF-β
overexpression plasmid. Next, the cells were incubated in
normoxia for 24 h. Both HIF-1α and HIF-2α can induce the
transcription of the luciferase reporter without HIF-β, with
HIF-1α producing a 20% increase and HIF-2α producing up
to a 3 (± 0.41)-fold increase over the control cells (Fig. 6a).
13
3638
J.-P. Tolonen et al.
A
B
C
E
D
F
With a co-overexpression of HIF-β, all HIF-α isoforms can
induce the EPO luciferase reporter by 34.2 (± 9.1)-fold, 41.6
(± 4.5)-fold, and 9.0 (± 2.3)-fold for HIF-1α, HIF-2α, and
HIF-3α2, respectively (Fig. 6b).
Finally, to further explore the transactivation capacity
of HIF-3α2, we co-overexpressed HIF-3α2 with HIF-1α
13
or HIF-2α and measured the relative luciferase activity
produced by the EPO luciferase reporter. Without HIF-β,
HIF-3α2 induced the relative luciferase activity by 17% and
21% over HIF-1α or HIF-2α alone, respectively (Fig. 6c,
d). With HIF-β, however, a co-overexpression of HIF-1α
or HIF-2α with HIF-3α2 produced a 45.6 (± 10.4)-fold and
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
◂Fig. 5 HIF-3α2 overexpression may result in frivolous HRE-depend-
ent chromatin binding. a ChIP-seq shows HIF-3α2 enrichment on
the HIST1H2BK gene near the promoter-TSS, co-localizing with a
site that contains four canonical HRE sequences. b ChIP-qPCR confirmation of HIF-3α2 binding on HIST1H2BK. c Luciferase reporter
construct containing the HIF-3α2 enrichment site on HIST1H2BK
shows statistically significant upregulation by HIF-1α and HIF-3α2.
Induction by HIF-3α2 plateaus already at the lower 100 ng transfection dosage. The data represent means (± SD) from three independent experiments, n = 8–9. d Four HREs observed in the HIF-3α2
enrichment site on HIST1H2BK were mutated to 5′-ATTTA-3′ to
study the HRE-dependency of HIF-3α2 and HIF-1α binding, showing
66–69% decrease in luminescence signal. The data represent means
(± SD) from four independent experiments, n = 11–12. e Hep3B cells
were incubated in normoxia (pO2 21%) and 1% hypoxia to study the
hypoxia-dependent expression of HIST1H2BK. Hypoxia downregulates HIST1H2BK expression by 25%, representing means (± SD)
from three independent experiments, n = 6. f Hep3B cells were
treated with control siRNA or siRNA targeting all splice variants
of the HIF3A locus, and incubated in 1% hypoxia for 24 h. HIF3A
knockdown upregulates HIST1H2BK expression by 65%. The data
represent means (± SD) from three independent experiments, n = 3.
*p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test
59.6 (± 14.0)-fold increase in the relative luciferase activity meaning that HIF-3α2 induced the luciferase activity by
34% and 44% over HIF-1α or HIF-2α alone, respectively
(Fig. 6c, d).
Discussion
The contributions of HIF-3 and especially those of the long
HIF-3α splicing variants to the regulation of the hypoxia
response are yet largely unknown. We set out here to study
the transactivation capacity of HIF-3α2 in more detail.
Among the long HIF-3α variants, HIF-3α2 has been previously shown to induce the highest upregulation of EPO
mRNA in Hep3B cells; HIF-3α2 is also expressed in the
fetal and adult liver and kidney, which are the main EPO
producing tissues [10, 12]. We explored HIF-3 target genes
by cDNA microarray analysis in Hep3B cells and concluded
that eight genes were upregulated by ≥ 2-fold with HIF-3α2
overexpression and 39 genes were downregulated by ≥ 2-fold
with siHIF3A treatment suggesting a HIF-3 specific transcriptional program. No overlap is observed between these
microarray data, because the HIF3A siRNA result in a
knockdown of all HIF-3α splice variants, while the overexpression experiments include only HIF-3α2. However, both
knockdown and overexpression settings result in positive
and negative effects on global gene expression suggesting
that HIF-3 plays a dual role in the hypoxia response. In the
context of overall hypoxia-dependent gene regulation, this
can be considered a small subset of genes as HIF-1 and
HIF-2 have been shown to regulate the transcription of over
1 500 human genes through direct transactivation according
to different ChIP assays [14, 15, 36, 37]. In zebrafish, the
3639
overexpression of the long Hif-3 splice variant resulted in
the upregulation of 136 unique genes, whereas Hif-1α overexpression upregulated up to 690 genes with 97 overlapping
targets [30], supporting the view that HIF-3 is responsible
for the oxygen-dependent regulation of a relatively small
subset of hypoxia-inducible genes.
We validated the role of HIF-3 in regulating EPO signaling in vitro. We have previously shown that siRNA knockdown of all HIF3A splice variants simultaneously results in
the downregulation of EPO mRNA in the Hep3B cell line
[12] that was originally used to study the hypoxia-dependent regulation of EPO [19]. Here, we show using Hep3B
and SK-N-AS, two cell lines capable of endogenous EPO
production, that loss and overexpression of HIF-3 results
in significant changes in EPO mRNA and protein levels,
further indicating that HIF-3 has a role in erythropoiesis
through EPO regulation. Of note, previous studies using
siRNA to target HIF1A mRNA in similar cell lines have not
produced significant effects in EPO expression [23, 27]. In
the murine cardiomyocytes, the knockdown of Hif3a has
been associated with a very minor upregulation of EPO
expression, but an upregulation of HIF-1α and HIF-2α
mRNA was also observed [38]. No human kidney-derived
cell lines with inducible EPO expression exist, while the
derivation of a murine kidney cell line with inducible EPO
expression was reported only recently [39].
The last line of evidence supporting our hypothesis that
HIF-3 is a transcription activator involved in the regulation
of EPO signaling arises from ChIP and transactivation studies. In Hep3B cells, HIF-3α2 binds chromatin immediately
5′ to the EPO gene, and this genomic region is sufficient
to transactivate a luciferase reporter construct by all three
HIF-α isoforms. Interestingly, HIF-3α2 enrichment is not
observed at the single HRE required for HIF-2 driven EPO
regulation at the liver inducibility element immediately 3′ to
EPO [17]. This may imply that HIF-3 does not compete for
the binding sites used by HIF-1 and HIF-2 as was recently
shown to be true between HIF-1 and HIF-2 despite a set of
shared target genes [15, 40]. Finally, using the HIST1H2BK
gene, we show that HIF-3 may redistribute to non-endogenous HREs upon overexpression and that chromatin occupancy studies should be paired with functional assays to
dissect endogenous target genes.
Our data are in line with previous studies about the biological function of the long HIF-3 isoforms. We have shown
that siRNA knockdown of all HIF3A splice variants and
overexpression of certain long HIF-3 isoforms downregulate
and upregulate, respectively, EPO, ANGPTL4, and GLUT1,
but not VEGF which is predominantly a HIF-1 target [12].
Similarly, Zhang and colleagues characterized the role of
Hif-3 as transcription activator in the zebrafish, and show
that hypoxia and overexpression of human HIF-3α9 [10]
induce LC3C, REDD1 and SQRDL expression in human
13
3640
J.-P. Tolonen et al.
A
B
C
D
Fig. 6 Synergistic induction of the EPO luciferase reporter by cooverexpression of HIF-1α or HIF-2α with HIF-3α2. a, b ChoK1
cells were transfected with the EPO luciferase reporter containing
the HIF-3α2 binding site near the EPO promoter-TSS and either the
HIF-1α, HIF-2α, or HIF-3α2 overexpression plasmid with or without
HIF-β in normoxia. All three HIF-α isoforms can induce the activity of the EPO luciferase reporter when co-overexpressed with HIF-β.
HIF-2α produces the most robust upregulation of the reporter. HIF-β
significantly enhances the transactivation capacity of all HIF-α isoforms. The data represent means (± SD) from three independent
experiments, n = 9. c, d Co-overexpression of HIF-1α or HIF-2α with
HIF-3α2 produces a synergistic upregulation of the EPO reporter,
representing means (± SD) from three independent experiments,
n = 9. The relative luciferase activity is normalized against the pRLCMV Renilla reporter. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed
Student’s t test
HEK293 and U2OS cell lines [30]. Furthermore, HIF-3α
has been implicated in the progression of pancreatic cancer
by directly binding the promoters of RHOC and ROCK1 and
transactivating the RhoC-ROCK1 pathway in cancer cells
that overexpress HIF3A [41].
The data presented in this study may provide basis for
human disease. Two single-nucleotide variants in the
HIF3A locus have been associated with familial erythrocytosis [42]. The data reported here suggest that it may be
through a direct transactivation effect. However, studies
that are more sensitive (i.e., ChIP-seq using antibodies that
recognize the endogenous HIF-3α protein, or RNA-seq to
study the kinetics of HIF3A splicing and expression) are
required to elucidate the role of HIF-3 further. Next, methylation of the HIF3A gene in blood cells and adipose tissue
was recently shown to correlate with increased body-mass
index in a genome-wide association study [43]. The data
suggest that impairment of the HIF pathway may result
in the dysregulation of body weight, which is in line with
previous studies showing that HIF prolyl 4-hydroxylase-2
inhibition and hence HIF-α stabilization and activation of
the hypoxia response pathway is protective of obesity and
metabolic dysfunction [44, 45]. We have shown that demethylation increases HIF3A mRNA levels in Hep3B cells
[10]. Here, we show that HIF-3α2 directly regulates the
expression of ANGPTL4, which is involved in the induction
of white adipose tissue lipolysis [46, 47] and may thus regulate energy metabolism. Other HIF-3 target genes identified
by cDNA microarray, such as ANGPTL3 and PANK1, may
also be involved in metabolic regulation [48–51]. This link
between HIF-3 and lipid metabolism may also explain why
only a few cancer cell lines express the long HIF3A splice
13
A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates…
variants, whereas the HIF-1α that drives glucose metabolism
is their major HIF form [10, 52]. However, further studies
are required to elucidate the direct mechanisms of HIF-3
dependent regulation of body weight.
In conclusion, our present study shows that HIF-3 is
involved in the regulation of a subset of hypoxia-inducible
genes. According to our chromatinimmunoprecipitation
data, HIF-3 directly binds EPO in its promoter-TSS at a
region harboring several HREs. This region is sufficient to
drive the transcription of a luciferase reporter gene. We provide evidence that HIF-3 is a transcription factor required
for maximal induction of EPO on mRNA and protein levels,
and that HIF-3α2 is more likely to produce synergistic than
inhibitory effects when co-overexpressed with HIF-1α or
HIF-2α. We would, therefore, suggest that the next step in
exploring the biological role of HIF-3 is to study murine
Hif3a splice variants in EPO regulation in vivo, but it should
be noted that splicing of the mouse Hif3a gene is far less
complex than that of the human HIF3A gene [6, 7, 10, 53].
Therefore, inactivating the individual human HIF3A splice
variants using the CRISPR-Cas9 technology or studying the
kinetics of HIF3A and HIF-β expression through RNA-seq
could be preferential approaches for future studies.
Acknowledgements Open access funding provided by University
of Oulu including Oulu University Hospital. We thank Anne Kokko
for her excellent technical assistance. We are grateful for Professor
Peppi Koivunen for providing the SK-N-AS neuroblastoma cell line.
This study was supported by the Academy of Finland Project Grant
296498, the Academy of Finland Center of Excellence 2012–2017
Grant 251314, the Sigrid Jusélius Foundation, the Jane and Aatos
Erkko Foundation, the Maud Kuistila Memorial Foundation, and
FibroGen Inc.
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativeco
mmons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate
credit to the original author(s) and the source, provide a link to the
Creative Commons license, and indicate if changes were made.
References
1. Loenarz C, Coleman ML, Boleininger A, Schierwater B, Holland
PWH, Ratcliffe PJ, Schofield CJ (2011) The hypoxia-inducible
transcription factor pathway regulates oxygen sensing in the simplest animal, Trichoplax adhaerens. EMBO Rep 12:63–70
2. Semenza GL (2012) Hypoxia-inducible factors in physiology and
medicine. Cell 148:399–408
3. Gordan JD, Simon MC (2007) Hypoxia-inducible factors: central regulators of the tumor phenotype. Curr Opin Genet Dev
17:71–77
4. Rankin EB, Giaccia AJ (2008) The role of hypoxia-inducible factors in tumorigenesis. Cell Death Differ 15:678–685
5. Hara S, Hamada J, Kobayashi C, Kondo Y, Imura N (2001)
Expression and characterization of hypoxia-inducible factor (HIF)-3α in human kidney: suppression of HIF-mediated
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
3641
gene expression by HIF-3α. Biochem Biophys Res Commun
287:808–813
Makino Y, Cao R, Svensson K, Bertilsson G, Asman M, Tanaka
H, Cao Y, Berkenstam A, Poellinger L (2001) Inhibitory PAS
domain protein is a negative regulator of hypoxia-inducible gene
expression. Nature 414:550–554
Makino Y, Kanopka A, Wilson WJ, Tanaka H, Poellinger L (2002)
Inhibitory PAS domain protein (IPAS) is a hypoxia-inducible
splicing variant of the hypoxia-inducible factor-3α locus. J Biol
Chem 277:32405–32408
Maynard MA, Qi H, Chung J, Lee EHL, Kondo Y, Hara S, Conaway RC, Conaway JW, Ohh M (2003) Multiple splice variants of
the human HIF-3α locus are targets of the von Hippel-Lindau E3
ubiquitin ligase complex. J Biol Chem 278:11032–11040
Tanaka T, Wiesener M, Bernhardt W, Eckardt K, Warnecke C
(2009) The human HIF (hypoxia-inducible factor)-3α gene is a
HIF-1 target gene and may modulate hypoxic gene induction.
Biochem J 424:143–151
Pasanen A, Heikkilä M, Rautavuoma K, Hirsilä M, Kivirikko KI,
Myllyharju J (2010) Hypoxia-inducible factor (HIF)-3α is subject
to extensive alternative splicing in human tissues and cancer cells
and is regulated by HIF-1 but not HIF-2. Int J Biochem Cell Biol
42:1189–1200
Pugh CW, O’Rourke JF, Nagao M, Gleadle JM, Ratcliffe PJ (1997)
Activation of hypoxia-inducible factor-1; definition of regulatory
domains within the α subunit. J Biol Chem 272:11205–11214
Heikkilä M, Pasanen A, Kivirikko KI, Myllyharju J (2011) Roles
of the human hypoxia-inducible factor (HIF)-3α variants in the
hypoxia response. Cell Mol Life Sci 68:3885–3901
Wenger RH, Stiehl DP, Camenisch G (2005) Integration of oxygen
signaling at the consensus HRE. Sci STKE 2005(306):re12
Schödel J, Oikonomopoulos S, Ragoussis J, Pugh CW, Ratcliffe
PJ, Mole DR (2011) High-resolution genome-wide mapping of
HIF-binding sites by ChIP-seq. Blood 117:207
Smythies JA, Sun M, Masson N, Salama R, Simpson PD, Murray
E, Neumann V, Cockman ME, Choudhry H, Ratcliffe PJ, Mole
DR (2019) Inherent DNA-binding specificities of the HIF-1α and
HIF-2α transcription factors in chromatin. EMBO Rep 20(1):
e46401
Gu YZ, Moran SM, Hogenesch JB, Wartman L, Bradfield CA
(1998) Molecular characterization and chromosomal localization
of a third alpha-class hypoxia inducible factor subunit, HIF3alpha.
Gene Expr 7(3):205–213
Haase VH (2013) Regulation of erythropoiesis by hypoxia-inducible factors. Blood Rev 27:41–53
Suzuki N (2015) Erythropoietin gene expression: developmentalstage specificity, cell-type specificity, and hypoxia inducibility.
Tohoku J Exp Med 235(3):233–240
Semenza GL, Dureza RC, Traystman MD, Gearhart JD, Antonarakis SE (1990) Human erythropoietin gene expression in transgenic
mice: multiple transcription initiation sites and cis-acting regulatory elements. Mol Cell Biol 10:930–938
Semenza GL, Nejfelt MK, Chi SM, Antonarakis SE (1991)
Hypoxia-inducible nuclear factors bind to an enhancer element
located 3′ to the human erythropoietin gene. Proc Natl Acad Sci
USA 88:5680–5684
Semenza GL, Koury ST, Nejfelt MK, Gearhart JD, Antonarakis
SE (1991) Cell-type-specific and hypoxia-inducible expression of
the human erythropoietin gene in transgenic mice. Proc Natl Acad
Sci USA 88:8725–8729
Rankin EB, Biju MP, Liu Q, Unger TL, Rha J, Johnson RS,
Simon MC, Keith B, Haase VH (2007) Hypoxia-inducible factor-2 (HIF-2) regulates hepatic erythropoietin in vivo. J Clin Invest
117:1068–1077
Chavez JC, Baranova O, Lin J, Pichiule P (2006) The transcriptional activator hypoxia inducible factor 2 (HIF-2/EPAS-1)
13
3642
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
J.-P. Tolonen et al.
regulates the oxygen-dependent expression of erythropoietin in
cortical astrocytes. J Neurosci 26:9471–9481
Storti F, Santambrogio S, Crowther LM, Otto T, Abreu-Rodríguez I, Kaufmann M, Hu C, Dame C, Fandrey J, Wenger RH,
Hoogewijs D (2014) A novel distal upstream hypoxia response
element regulating oxygen-dependent erythropoietin gene expression. Haematologica 99:45
Hirano I, Suzuki N, Yamazaki S, Sekine H, Minegishi N, Shimizu
R, Yamamoto M (2017) Renal anemia model mouse established
by transgenic rescue with an erythropoietin gene lacking kidneyspecific regulatory elements. Mol Cell, Biol, p 37
Shih HM, Wu CJ, Lin SL (2018) Physiology and pathophysiology of renal erythropoietin-producing cells. J Formos Med Assoc
117:888–893
Warnecke C, Zaborowska Z, Kurreck J, Erdmann VA, Frei U,
Wiesener M, Eckardt KU (2004) Differentiating the functional
role of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha
(EPAS-1) by the use of RNA interference: erythropoietin is
a HIF-2alpha target gene in Hep3B and Kelly cells. FASEB J.
18(12):1462–1464
Kobayashi S, Yamashita T, Ohneda K, Nagano M, Kimura K,
Nakai H, Poellinger L, Ohneda O (2015) Hypoxia-inducible
factor-3α promotes angiogenic activity of pulmonary endothelial
cells by repressing the expression of the VE-cadherin gene. Genes
Cells 20:224–241
Maynard MA, Evans AJ, Hosomi T, Hara S, Jewett MAS, Ohh
M (2005) Human HIF-3α4 is a dominant-negative regulator of
HIF-1 and is down-regulated in renal cell carcinoma. FASEB J
19:1396–1406
Zhang P, Yao Q, Lu L, Li Y, Chen P, Duan C (2014) Hypoxiainducible factor 3 is an oxygen-dependent transcription activator
and regulates a distinct transcriptional response to hypoxia. Cell
Rep 6:1110–1121
Zhang P, Bai Y, Lu L, Li Y, Duan C (2016) An oxygen-insensitive
Hif-3α isoform inhibits Wnt signaling by destabilizing the nuclear
β-catenin complex. eLife 5:e08996
Olsson L, Johansson B (2015) Ikaros and leukaemia. Br J Haematol 169:479–491
Kallio MA, Tuimala JT, Hupponen T, Klemelä P, Gentile M,
Scheinin I, Koski M, Käki J, Korpelainen EI (2011) Chipster:
user-friendly analysis software for microarray and other highthroughput data. BMC Genom 12:507
Paakinaho V, Kaikkonen S, Makkonen H, Benes V, Palvimo JJ
(2014) SUMOylation regulates the chromatin occupancy and antiproliferative gene programs of glucocorticoid receptor. Nucleic
Acids Res 42:1575–1592
Duan C (2016) Hypoxia-inducible factor 3 biology: complexities
and emerging themes. Am J Physiol Cell Physiol 310(4):260
Mole DR, Blancher C, Copley RR, Pollard PJ, Gleadle JM,
Ragoussis J, Ratcliffe PJ (2009) Genome-wide association of
hypoxia-inducible factor (HIF)-1α and HIF-2α DNA binding with
expression profiling of hypoxia-inducible transcripts. J Biol Chem
284:16767–16775
Prabhakar NR, Semenza GL (2015) Oxygen sensing and homeostasis. Physiology (Bethesda) 30:340–348
Drevytska T, Gonchar E, Okhai I, Lynnyk O, Mankovska I, Klionsky D, Dosenko V (2018) The protective effect of Hif3a RNA
interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation. Life Sci 202:131–139
Imeri F, Nolan KA, Bapst AM, Santambrogio S, Abreu-Rodríquez
I, Spielmann P, Pfundstein S, Libertini S, Crowther L, Orlando
IMC, Dahl SL, Keodara A, Kuo W, Kurtcuoglu V, Scholz CC, Qi
W, Hummler E, Hoogewijs D, Wenger RH (2019) Generation of
renal Epo-producing cell lines by conditional gene tagging reveals
rapid HIF-2 driven Epo kinetics, cell autonomous feedback regulation, and a telocyte phenotype. Kidney Int 95(2):375–387
13
40. Bartoszewski R, Moszynska A, Serocki M, Cabaj A, Polten A,
Ochocka R, Dell’Italia L, Bartoszewska S, Króliczewski J, Dabrowski M, Collawn JF (2019) Primary endothelial cell-specific
regulation of hypoxia-inducible factor (HIF)-1 and HIF-2 and
their target gene expression profiles during hypoxia. FASEB J.
33(7):7929–7941
41. Zhou X, Guo X, Chen M, Xie C, Jiang J (2018) HIF-3α promotes
metastatic phenotypes in pancreatic cancer by transcriptional
regulation of the RhoC-ROCK1 signaling pathway. Mol Cancer
Res 16:124–134
42. Krista A, Debeljak N, Kunej T (2019) Genetic variability of
hypoxia-inducible factor alpha (HIFA) genes in familial erythrocytosis: analysis of the literature and genome databases. Eur J
Haematol 103(4):287–299
43. Dick KJ, Nelson CP, Tsaprouni L, Sandling JK, Aïssi D, Wahl
S, Meduri E, Morange P, Gagnon F, Grallert H, Waldenberger
M, Peters A, Erdmann J, Hengstenberg C, Cambien F, Goodall
AH, Ouwehand WH, Schunkert H, Thompson JR, Spector TD,
Gieger C, Trégouët D, Deloukas P, Samani NJ (2014) DNA methylation and body-mass index: a genome-wide analysis. Lancet
383:1990–1998
44. Matsuura H, Ichiki T, Inoue E, Nomura M, Miyazaki R, Hashimoto T, Ikeda J, Takayanagi R, Fong G, Sunagawa K (2013) Prolyl
hydroxylase domain protein 2 plays a critical role in diet-induced
obesity and glucose intolerance. Circulation 127:2078–2087
45. Rahtu-Korpela L, Karsikas S, Hörkkö S, Blanco Sequeiros
R, Lammentausta E, Mäkelä KA, Herzig K, Walkinshaw G,
Kivirikko KI, Myllyharju J, Serpi R, Koivunen P (2014) HIF
prolyl 4-hydroxylase-2 inhibition improves glucose and lipid
metabolism and protects against obesity and metabolic dysfunction. Diabetes 63:3324–3333
46. Gray NE, Lam LN, Yang K, Zhou AY, Koliwad S, Wang J (2012)
Angiopoietin-like 4 (Angptl4) protein is a physiological mediator of intracellular lipolysis in murine adipocytes. J Biol Chem
287:8444–8456
47. McQueen AE, Kanamaluru D, Yan K, Gray NE, Wu L, Li M,
Chang A, Hasan A, Stifler D, Koliwad SK, Wang J (2017) The
C-terminal fibrinogen-like domain of angiopoietin-like 4 stimulates adipose tissue lipolysis and promotes energy expenditure. J
Biol Chem 292:16122–16134
48. Leonardi R, Rehg JE, Rock CO, Jackowski S (2010) Pantothenate
kinase 1 is required to support the metabolic transition from the
fed to the fasted state. PLoS One 5:e11107
49. Leonardi R, Rock CO, Jackowski S (2014) Pank1 deletion in leptin-deficient mice reduces hyperglycaemia and hyperinsulinaemia
and modifies global metabolism without affecting insulin resistance. Diabetologia 57:1466–1475
50. Zano SP, Pate C, Frank M, Rock CO, Jackowski S (2015) Correction of a genetic deficiency in pantothenate kinase 1 using
phosphopantothenate replacement therapy. Mol Genet Metab
116:281–288
51. Kersten S (2017) Angiopoietin-like 3 in lipoprotein metabolism.
Nat Rev Endocrinol 13:731–739
52. Denko NC (2008) Hypoxia, HIF1 and glucose metabolism in the
solid tumour. Nat Rev Cancer 8:705–713
53. Yamashita T, Ohneda O, Nagano M, Iemitsu M, Makino Y,
Tanaka H, Miyauchi T, Goto K, Ohneda K, Fujii-Kuriyama Y,
Poellinger L, Yamamoto M (2008) Abnormal heart development
and lung remodeling in mice lacking the hypoxia-inducible factorrelated basic helix-loop-helix PAS protein NEPAS. Mol Cell Biol
28:1285–1297
Publisher’s Note Springer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional affiliations.