← Back
Ru(II)/diphenylphosphine/pyridine-6-thiolate complexes induce S-180 cell apoptosis through intrinsic mitochondrial pathway involving inhibition of Bcl-2 and p53/Bax activation.
Molecular and Cellular Biochemistry (2018) 444:109–123
https://doi.org/10.1007/s11010-017-3236-1
The role of resveratrol on skeletal muscle cell differentiation
and myotube hypertrophy during glucose restriction
Hannah F. Dugdale2 · David C. Hughes3 · Robert Allan4 · Colleen S. Deane5 · Christopher R. Coxon6 ·
James P. Morton2 · Claire E. Stewart2 · Adam P. Sharples1,2
Received: 31 August 2017 / Accepted: 24 November 2017 / Published online: 30 November 2017
© The Author(s) 2017. This article is an open access publication
Abstract
Glucose restriction (GR) impairs muscle cell differentiation and evokes myotube atrophy. Resveratrol treatment in skeletal
muscle cells improves inflammatory-induced reductions in skeletal muscle cell differentiation. We therefore hypothesised
that resveratrol treatment would improve muscle cell differentiation and myotube hypertrophy in differentiating C2C12
myoblasts and mature myotubes during GR. Glucose restriction at 0.6 g/L (3.3 mM) blocked differentiation and myotube
hypertrophy versus high-glucose (4.5 g/L or 25 mM) differentiation media (DM) conditions universally used for myoblast
culture. Resveratrol (10 µM) treatment increased SIRT1 phosphorylation in DM conditions, yet did not improve differentiation
when administered to differentiating myoblasts in GR conditions. Resveratrol did evoke increases in hypertrophy of mature
myotubes under DM conditions with corresponding elevated Igf-I and Myhc7 gene expression, coding for the ‘slow’ type I
MYHC protein isoform. Inhibition of SIRT1 via EX-527 administration (100 nM) also reduced myotube diameter and area
in DM conditions and resulted in lower gene expression of Myhc 1, 2 and 4 coding for ‘intermediate’ and ‘faster’ IIx, IIa
and IIb protein isoforms, respectively. Resveratrol treatment did not appear to modulate phosphorylation of energy-sensing
protein AMPK or protein translation initiator P70S6K. Importantly, in mature myotubes, resveratrol treatment was able to
ameliorate reduced myotube growth in GR conditions over an acute 24-h period, but not over 48–72 h. Overall, resveratrol
evoked myotube hypertrophy in DM conditions while favouring ‘slower’ Myhc gene expression and acutely ameliorated
impaired myotube growth observed during glucose restriction.
Keywords SIRT1 · Dietary restriction · Myoblasts · Hypertrophy · Atrophy · MYHC · P70S6K · AMPK · MYHC
Introduction
Calorie Restriction (CR) promotes improvements in
lifespan and healthspan in mammalian organisms due to
chronic reductions in Insulin/Insulin-like-Growth-Factor-I
(IGF-I) signalling, inflammation, DNA damage and oxidative stress (reviewed in [1]). However, reductions in IGF-I
* Adam P. Sharples
a.p.sharples@googlemail.com
1
2
Institute for Science and Technology in Medicine
(ISTM), School of Medicine, Keele University, The Guy
Hilton Research Centre, Thornburrow Drive, Hartshill,
Staffordshire ST4 7QB, UK
Stem Cells, Ageing and Molecular Physiology Research
(SCAMP) Unit, Exercise Metabolism and Adaptation
Research Group (EMARG), Research Institute for Sport
and Exercise Sciences (RISES), Liverpool John Moores
University, Liverpool, UK
and downstream IGF-IR/protein kinase B (AKT)/mTOR/
P70S6K negatively affect skeletal muscle mass via reductions in protein synthesis [2–6], muscle cell proliferation,
differentiation and survival [7, 8]. In skeletal muscle, calorie restriction results in reduced IGF-I levels, a threefold
reduction in Akt mRNA and 30–50% reduction in Akt protein activity, with corresponding increases in FoxO3a gene
3
Department of Internal Medicine, Division of Endocrinology
and Metabolism, Carver College of Medicine, University
of Iowa, Iowa City, IA 52246, USA
4
Centre for Applied Sport and Exercise Sciences, University
of Central Lancashire, Preston, UK
5
Department of Sport and Health Sciences, College of Life
and Environmental Sciences, University of Exeter, Exeter,
UK
6
School of Pharmacy and Biomolecular Sciences, Liverpool
John Moores University, Liverpool, UK
13
Vol.:(0123456789)
110
expression [9], leading to transcription of muscle-specific
ubiquitin ligases/atrogenes MuRF-1 and MAFbx that ‘tag’
cytoskeletal and myofibrillar proteins for degradation in the
proteasome [10–12]. Therefore, during CR a paradox exists
where an attempt by the organism to improve longevity via
reductions in IGF signalling are potentially at the expense
of a loss in skeletal muscle regenerative capacity and mass
(reviewed in [1]). As a consequence, using pharmacological or naturally derived agents that maintain muscle while
calorie restricted would potentially be advantageous to
improve health/lifespan while reducing the loss of muscle
mass. Research into the activation of the Sirtuins (SIRT17), a group of protein deacetylases involved in the process
of chromatin remodelling and gene regulation (see [13], by
a naturally occurring polyphenol resveratrol (contained in
the skin of red grapes), has provided some insights into the
Sirtuins’ potential in both enabling improved healthspan and
maintaining muscle cell regenerative function.
Indeed these insights suggest that reductions in SIRT1
activity in skeletal muscle occur following acute fasting in
mice, with a corresponding increase in protein degradative
MuRF-1 and MAFbx and reductions in muscle mass [14].
Our group has also shown that the induction of apoptosis
and inhibition of differentiation in murine skeletal muscle
cells by high-dose inflammatory cytokine, Tumour Necrosis
Factor-alpha (TNF-α), was associated with increased SIRT1
mRNA levels, which when suppressed using silencing RNA
resulted in exacerbated apoptosis [15, 16]. Importantly, the
Sirtuin activator resveratrol was able to attenuate apoptosis
and improve differentiation back towards baseline levels,
suggesting that Sirtuin activation was important to survival
and differentiation of skeletal muscle cells under a catabolic
inflammatory stress. More recent studies have confirmed
these findings, where resveratrol was also able to reverse
impairments protein activity of Akt, mTOR, P70S6K and
4E-BP1 following TNF-α treatments in C2C12 cells [17]. It
has also been demonstrated that resveratrol can reduce agerelated ill health in ad libitum fed aged mice if administered
from mid-age, albeit without impact on lifespan [18, 19],
and can extend lifespan when mice are placed under nutrient stress from a high fat diet [20]. Therefore, resveratrol
has the potential to reduce the impact of metabolic stress
while helping maintain appropriate muscle cell function for
skeletal muscle maintenance and regener ation.
Due to the requirement for adequate SIRT1 activation
in muscle cell survival in vitro [16], an identified role for
SIRT1 activation in regeneration/differentiation during
inflammation in vitro and nutrient stress in vivo [20], we
aimed to investigate whether Sirtuin activation via resveratrol treatment in skeletal muscle cells would attenuate loss of
differentiation and myotube hypertrophy in both regenerating myoblasts and existing mature myotube cultures while
modelling CR conditions in vitro. Reducing carbohydrate
13
Molecular and Cellular Biochemistry (2018) 444:109–123
and glucose intake is a common approach when undertaking
CR (reviewed in [21]). Therefore, glucose restriction (GR)
has been used to model CR in vitro in cell types such as
yeast [22], fibroblasts [23] and kidney cells [24]. In muscle
cells, previous studies have used low glucose concentrations in vitro in an attempt to mimic circulatory glucose
levels experienced during CR in vivo [25, 26]. However,
the amount of glucose that muscle cells would actually be
exposed to in the interstitial space during CR has not yet
been modelled in vitro. The previously reported values for
blood glucose during CR are 0.74 g/L (4.1 mM) in humans
[27] and 1 g/L (5.6 mM) in murine models [28]. Glucose
values in the muscle interstitial space have been reported to
be 30% lower than those found in the blood of both rodents
[29] and humans [30]. Therefore, applying the aforementioned 30% reduction would estimate glucose in the interstitial space at between 0.5 and 0.7 g/L (2.8 and 3.9 mM) for
humans and rodents, respectively. Therefore, in the present
study, we used 0.6 g/L of glucose in vitro to model interstitial glucose levels under CR in vivo. Both differentiating
C2C12 myoblasts and mature myotubes were then investigated over time in GR conditions in the absence or presence
of Sirtuin activator resveratrol and SIRT1 inhibitor, EX-527.
These conditions were compared to conditions of 4.5 g/L
(25 mM) high-glucose differentiation (DM) media that is
universally and routinely used for both proliferating and differentiating skeletal muscle cells in vitro, with high-glucose
DMEM used extensively in studies investigating the effect
of resveratrol in C2C12 myoblasts [17, 31–34]. Overall, we
hypothesised that (1) resveratrol treatment would help preserve differentiation and myotube hypertrophy in differentiating myoblasts under glucose restriction, and (2) resveratrol would improve myotube survival and prevent myotube
atrophy in mature differentiated myotubes following glucose
restriction (GR).
Methods
Cell culture
C2C12 murine myoblasts [35] between passage 8 and 10
were incubated in separate T75 flasks in a humidified environment (37 °C, 5% C
O2) with growth media (GM) containing Dulbecco’s Modified Eagle Serum (DMEM) (D6429,
Sigma-Aldrich, UK), 1% Penicillin Streptomycin (Penstrep), 10% New born calf serum (NBCS) and 10% Foetal
Bovine Serum (FBS) until 80% confluency was attained.
Cells were trypsinized and cell counts were preformed using
a haemocytometer in the presence of Trypan Blue dye. For
studies in differentiating myoblasts, 6-well plates were pretreated with 0.2% porcine gelatin for 10 min at room temperature (RT) and 10 min in a humidified, 37 °C/5% CO2
Molecular and Cellular Biochemistry (2018) 444:109–123
environment. The excess gelatin was aspirated and cells were
seeded at 8 × 104 cells/ml in 2 ml of GM per well, these were
then incubated for 24 h until 80% confluency was attained.
Experiments were initiated by removing GM, washing twice
with phosphate buffered saline (PBS) followed by the addition of low serum differentiation media for a total period
of 7 days, containing: 8.3 g/L of DMEM (D5030, SigmaAldrich, UK), 0.584 g/L l-Glutamine, 3.7 g/L Sodium
Bicarbonate, 0.11 g/L Sodium Pyruvate, 0.0159 g/L Phenol
red, 2% horse serum and 1% Pen-strep and either 0.6 g/L or
3.3 mM (glucose restricted/GR) or 4.5 g/L (25 mM) highglucose differentiation medium (DM) universally used for
myoblast proliferation and differentiation and used extensively in previous studies assessing the role of resveratrol
in C2C12 cells [17, 31–34], whilst also allowing relevant
comparisons with the existing literature. The reduction in
serum content causes C2C12 myoblasts to undergo spontaneous differentiation without requiring the addition of
growth factors to initiate the process [35]. Time point zero
was defined as an incubation of 30 min after transfer to DM
and is denoted as 0 h (0 h). To assess the effect of resveratrol treatment and SIRT1 inhibition in myoblasts that were
glucose restricted (GR) versus high-glucose differentiation
media (DM), cells were incubated in either 0.6 g/L / 3.3 mM
(GR) versus 4.5 g/L / 25 mM (DM) in the absence or presence of resveratrol (RES) at a concentration of 10 µM and
SIRT1 inhibitor (EX-527) at 100 nM. Morphological analysis (myotube number, diameter and area), creatine kinase
assays, and RNA extraction/ isolation for gene expression of
genes associated with muscle cell differentiation (myogenin)
and myotube maturation (Myhc 1, 2, 4, 7) were conducted
at 0, 72 h and 7 days.
For studies in differentiated myotubes, myoblasts at passages 12–15 were washed in PBS and transferred into 2 ml
of DM in 37 °C at 5% CO2 for 7 days in order to differentiate. Once myotubes had been formed over 7 days, cells were
dosed in the below experimental conditions for a further
72 h (total time 10 days in culture) to assess the impact of
resveratrol and EX-527 treatment during glucose restriction
(GR) conditions in existing myotubes: GR differentiation
media (0.6 g/L / 3.3 mM glucose alone), High-glucose differentiation media (DM) (4.5 g/L glucose alone), GR + Resveratrol (RES) (0.6 g/L glucose + 10 μM RES), DM + RES
(4.5 g/L glucose + 10 μM RES), GR + EX-527 (0.6 g/L
glucose + 100 nM EX-527) and DM + EX-527 (4.5 g/L glucose + 100 nM EX-527). Resveratrol/EX-527 was purchased
from Merck Millipore (cat no 554325/566322, respectively,
Nottingham, UK). Resveratrol was manufactured by Calbiochem (cat no CAS 501-36-0, San Diego, CA, USA).
Resveratrol/EX-527 was reconstituted in DMSO and this
stock was stored in -20 °C for up to three/six months, respectively, according to the manufacturer’s instructions. Morphological analysis of myotube number, diameter and area
111
were performed 24, 48 and 72 h. For these experiments,
the 0 h (0 h) baseline control condition was 7 days in DM
to promote myotube formation, after which time cells were
washed × 2 in PBS and then placed in fresh DM for 30 min
containing (denoted DM 0 h). Protein activity of AMPK
and P70S6K was analysed from protein lysates extracted
at 0-, 15- and 30-min, 2- and 24-h time points after dosing
occurred in myotubes in order to investigate energy sensing
vs. protein synthetic/growth-associated cellular signalling
following resveratrol and EX-527 administration in existing myotubes in GR versus DM glucose conditions. Gene
expression for later differentiation and myotube maturation
(Mrf4, Myhc1, 2, 4, 7) and genes associated with myotube
hypertrophy (Igf-I, Igf-Ir, Igf-II, Igf-IIr, Igfbp2, Mtor), myotube atrophy (Tnf-α, Tnfrsflb, Myostatin, Mur1f, Mafbx,
Musa1, Fox01, 3, Nf-kb, p53) as well as Sirt1 gene expression were completed at 0, 24 and 72 h.
Morphology to assess differentiation and myotube
hypertrophy/atrophy
Myotube parameters including number, diameter and area
were assessed using a live imaging light microscope (AF600
modular system, Leica, Germany) cell imaging system
at ×10 or ×20 magnifications (see figure legends for details).
Per experiment, each time point and experimental condition
was imaged in duplicate with six images taken per well providing a total of 12 images per condition per time point per
n. Experiments were then repeated n = 3. Automated mark
and find on the Leica AF600 microscope allowed six images
per well to be taken in the same position between conditions
automatically, with the 6 locations chosen equally spread
around the well. Analysis of myotube number, diameter and
area was performed on the images using ImageJ software
((National Institutes of Health, USA) as previously defined
in [36–38].
Creatine kinase assay
Cells were extracted for total protein assays and CK (creatine
kinase) activity (a biochemical marker of myoblast differentiation) at 0, 72 and 7 days in differentiating C2C12 myoblasts. Briefly, cells were washed twice in PBS and lysed in
250 µl well−1 of 0.05 M Tris/MES Triton lysis buffer (TMT:
50 mM Tris-MES, pH 7.8, 1% Triton X-100) and assayed
using commercially available BCA™ (Pierce, Rockford, IL,
U.S.A) and CK activity (Catachem Inc., Connecticut, N.E,
USA) assay kits according to the manufacturer’s instructions. The enzymatic activity for CK was normalised to total
protein content. CK and total protein were determined using
a CLARIOstar® plate reader (BMG labtech, Germany) at a
wave length of 340 nm and 540–590 nm, respectively.
13
112
RNA isolation and quantification
RNA isolation was performed using the TRIzol method,
following the manufacturer’s instructions (Invitrogen, Life
technologies, Carlsbad, CA). RNA purity and concentration
were assessed using 1 μl of sample on a NanoDrop 2000c,
UV–Vis (Ultraviolet–Visible spectroscopy) spectrophotometer (Thermo Fisher Scientific, MA, USA) using ODs of 230,
260 and 280 nm. A ratio of these OD value was calculated for
each sample with all samples possessing 260/280 ratios of
between 1.8 and 2.2 and therefore accepted as high enough
quality RNA to enable downstream RT-PCR analysis.
Primer design
Primer sequences (Table 1) were identified using Gene
(NCBI, http://www.ncbi.nlm.nih.gov/gene) and designed
using both web-based OligoPerfectTM Designer (Invitrogen, Carlsbad, CA, USA) and Primer-BLAST (NCBI, http://
www.ncbi.nlm.nih.gov/tools/primer-blast), with the exception of IGF-I mature peptide mRNA primers that were used
in [39]. Primers were purchased from Sigma (Suffolk, UK)
without the requirement of further purification. Sequence
homology (BLAST) searches ensured specificity to ensure
the primers matched the sequence and therefore gene that
they were designed for. Three or more GC bases in the
last five bases at the 3′ end of the primer were avoided as
stronger bonding of G and C bases can cause non-specific
amplification. Primer sequences were designed to exclude
hairpins, self-dimer and cross-dimers. All primers details
can be found in Table 1.
Gene expression by rt‑qRT‑PCR
Rt-qRT-PCR was carried out using Quantifast SYBR green
RT-PCR kit (Qiagen, Manchester, UK) on a Rotor-Gene®
(Qiagen, Manchester, UK) supported by Rotor-Gene® Q
Software, version 2.1.0.9 (Qiagen, Manchester, UK). The
rt-qRT-PCR cycles consisted of the following: 48 °C,
30 min (reverse transcription/ cDNA synthesis); 95 °C,
10 min (transcriptase inactivation and initial denaturation)
followed by 40 cycles of 95 °C, 15 s (denaturation); 60 °C,
1 min (annealing and extension in 1 step). Disassociation
melt-curve analysis was performed to reveal and therefore
exclude non-specific amplification and primer dimer issues.
All our gene products yielded a single melt peak/temperature suggesting that one product was amplified. Relative
gene expression analysis was carried out using ΔΔCt equation, otherwise known as the Livak method [40], this was
to establish normalised expression ratios, where the relative
expression was calculated as 2 −ΔΔCt and Ct represents the
cycle threshold. RT-PCR efficiency was similar across RTPCR runs and conditions (90.99 ± 2.28%, variation 2.48%).
13
Molecular and Cellular Biochemistry (2018) 444:109–123
Polr2ß (a.k.a Rp-IIb) was also extremely stable between
experimental conditions (mean Ct 15.62 ± 0.11) and therefore used as the reference gene in all RT-PCR assays and
the pooled mean used in the ΔΔCt calculations. All rt-qRTPCR figures are presented as a relative gene expression
in comparison to the 0 h cells incubated in DM glucose
(4.5 g/L / 25 mM). This 0 h sample was used as a calibrator
condition in the subsequent equations in order to compare
expression values across glucose concentrations.
SDS‑PAGE and western blotting
Cells were lysed in 300 µl lysis buffer per well of a 6-well
plate, including phosphatase inhibitors (10 mM TrisHCL,
5 mM EDTA, 50 mM Sodium Chloride, 30 mM Sodium
Pyrophosphate, 50 mM Sodium Fluoride, 100 μM Sodium
Orthovanadate, 1 mM PMSF and 1% Triton X-100.) supplemented with protease inhibitor tablets as per the manufacturer’s instructions (Roche, Switzerland). Following
analysis of total protein via BCA assay as above, 30 µg
of protein was reconstituted in 1:5 dilution with 5X Laemmli buffer (3 ml 1M TRIS–HCl (pH 6.8.), 1 g Sodium
dodecyl sulphate, 5 ml glycerol, 1 ml D
H2O and 25 mg
Bromophenol blue). Ten percent resolving SDS-Polyacrylamide (SDS-Page) gels (4 ml 30% acrylamide 1%
BIS solution, 3.4 ml DH2O, 2.5 ml 1.5M Tris Base, 100 μl
10% SDS, 50 μl 10% APS and 5 μl TEMED) were poured,
and a layer of butanol was then syringed across the top
of the resolving solution and cast for 30 min. Following
butanol removal, a 5% stacking gel solution (1.7 ml 30%
acrylamide 1% BIS solution, 5.7 ml D
H2O, 2.5 ml 0.5M
Tris Base, 100 μl 10% SDS, 50 μl 10% APS and 10 μl
TEMED) was poured and a lane comb inserted. These gels
were run at 200 V in a Mini- PROTEAN® Tetra vertical
electrophoresis cell (Bio-Rad Laboratories, Inc. CA, USA)
until the bromophenol blue dye line reached the bottom of
the gel (approximately 1 h). The protein was then transferred for 30 min at 200 V onto a nitrocellulose membrane
within a semi-dry Trans-blot® Turbo™ Blotting system cassette (Bio-Rad Laboratories, Inc. CA, USA) using transfer buffer (20 ml 10 × Tris Glycine, 40 ml methanol and
140 ml DH2O). The nitrocellulose membrane was prepared
for detection of specific phosphorylated and total proteins
using a Pierce™ Fast Western Kit, Supersignal West Pico
(Rabbit) (Thermofisher scientific, MA, USA) as per the
manufacturer’s instructions including timings for incubation, with the following primary antibodies (all raised in
rabbit) purchased from Cell Signalling Technology, MA,
USA unless otherwise stated: Phospho AMPK 1:1000
(cat no: #2535), total AMPK 1:1000 (#2532), phospho
P70S6K 1:1000 (#9205), total P70S6K 1:1000 (#9202),
phospho SIRT1 1:2000 (#2314L) and total SIRT 1:2000
(Millipore, Watford, UK cat no: #07-131). Incubation with
Molecular and Cellular Biochemistry (2018) 444:109–123
Table 1 Primer details for gene
expression analysis
113
Gene
Primer Sequence (5′-3′)
Reference number
Amplicon
length (bp)
MyoD
F: CATTCCAACCCACAGAAC
R: GGCGATAGAAGCTCCATA
F: GGCTCTCCTTTGTATCCAGGG
R: CGATCTGTGGGGGCAGATTT
F: CCAACTGAGATTGTCTGTC
R: GGTGTTAGCCTTATGTGAAT
F: CGGTCGAAGTTGCATCCCTA
R: TTCTGAGCCTCGATTCGCTC
F: GCGAAGAGTAAGGCTGTCCC
R: GGCGCATGACCAAAGGTTTC
F: AGGAGGCTGAGGAACAATCC
R: TTCTCCTGTCACCTCTCAACA
F: TGTGCTACCCAGCTCCAAG
R: CTGCTTCCACCTAAAGGGCTG
F: CCTTGAGGCTCCCGGCAAAT
R: ACTGCTCCACAAACCAATGGA
F: ACAATTCCTCCACCTGAG
R: GTAACTTCACAGCATCTTCAA
F: TACTCCAGAATAGAAGCCATAA
R: GTAGCGTGATAATCGTCATC
F: GCTTGCTCACCTTTACCAGC
R: TTGGGCATGTCAGTGTGG
F: TGCGGTGTCCAATAACTAC
R: TGTTGATGGTGGTCTTCTC
F: GTACAATATCTGGCCCGCCC
R: GTATGCAAACCGAACAGCGG
F: GGAACTCCTGAATTTGTAACT
R: CTACCAGATAGCCACCATT
F: AGTGCCATCTCTTCTACAA
R: GCTCAGTGTTGGTCTCTT
F: CACTCCACTATCCTGTTACCT
R: GAGATCCTTGGCACACCT
F: CCAAGGAGAATAGCCACCAG
R: CGCTCTTCTTCTCGTCCAG
F: GTCGCAGCCAAGAAGAGAA
R: CGAGAAGTCCAGTCTGTTGAA
F: AGTGGATGGTGAAGAGCGTG
R: GAAGGGACAGATTGTGGCGA
F: CGGACAAACGGCTCACTTT
R: TCGGCTCTTGGTGTACTTG
F: TCAACAACTACTCAGAAACAC
R: AGAACTCAGGAATGGACAT
F: GTTGCTCTGTTATAGGATGGT
R: TGCTGTCTGCTGTCTACT
F: ACACGAGGCTACAACTCTGC
R: GGTACCCCCAGAGACCTCAT
F: CATCCTGGCTGTAGGTAGCG
R: GGCAGTCATCCAGTCTTCGG
F: GGTCAGAAGGGAACTTGTGGTAT
R: GCATCATTAAATGGAGTAGCGTC
NM_010866.2
125
NM_008657.2
194
NM_031189.2
173
NM_030679.1
149
NM_001039545.2
76
NM_010855.3
192
NM_080728.2
77
NM_001168297.1
189
NM_019812.3
124
NM_010834.3
194
NM_010512.5
280
NM_010513.2
110
NM_010514.3
188
NM_010515.2
181
NM_008342.3
197
NM_020009.2
190
NM_001039048.2
84
NM_026346.3
156
NM_019739.3
96
NM_019740.2
272
NM_013693.3
130
NM_011610.3
114
NM_008689.2
164
NM_011640.3
109
NM_153798.2
197
Mrf4 (Myf6)
Myogenin
Myhc1
Myhc2
Myhc4
Myhc7
Musa1
Sirt1
Myostatin
Igf-I
Igf-Ir
Igf-II
Igf-IIr
Igfbp2
Mtor
Murf1
Mafbx
FoxO1
FoxO3
Tnf-α
Tnfrsf1b
Nf-κβ
p53
RpIIb (a.k.a: pol2rb)
the secondary rabbit HRP antibody, was also provided in
the above P
ierce™ Fast Western Kit and applied as per the
manufacturer’s instructions. Enhanced chemilluminescence
(ECL) detection reagents as provided by the P
ierce™ Fast
Western Kit described above were used in a 1:1 dilution
and incubated over the membrane for 5 min. The membrane
13
114
was then placed in the Chemidoc™ MP System (Bio-Rad
Laboratories, Inc. CA, USA.) where the band images were
detected by densitometry in which the first image was taken
at 5 s and intervals of 30.5 s thereafter. Following imaging,
the band volumes were detected using Image lab™ (BioRad Laboratories, Inc. CA, USA.). The bands for the phosphorylated protein were relativised to its own total protein
counterpart before determining changes between experimental groups. GAPDH was detected on all membranes
prior to further detection. To establish whether loading of
protein was comparable, we determined the volume values
for GAPDH (GAPDH concentration 1:4000, Cell Signalling Technology, MA, USA cat no: #5174). In the unlikely
event that GAPDH was significantly different between conditions, the samples were also relativised to the GAPDH
loading control.
Statistical analysis
All data analyses were carried out using M
initab ® 17
(Minitab Ltd, Coventry U.K). Outliers were removed using
Grubbs outlier test. All data were parametric, assessed using
the Anderson–Darling test for normality. For statistical analysis of the dependent variables investigated in differentiating
myoblasts, a general linear model (2 × 2 × 3) for time (72 h,
7 days), glucose concentration (GR, DM) and resveratrol/
EX-527 treatment (DM, RES, EX-527) where carried out
for morphological analysis of myotube number, diameter
and area. For CK activity and gene expression, a general
linear model (4 × 2 × 3) for time (0, 24, 72 h, 7 days), glucose
concentration (GR, DM) and resveratrol/EX-527 treatment
(DM, RES, EX-527) was conducted. For statistical analysis of the dependent variables investigated in differentiated
myotubes (already differentiated for 7 days prior to treatments), a general linear model (2 × 2 × 3) for time (0, 72 h),
glucose concentration (GR, DM) and resveratrol/EX-527
treatment (DM, RES, EX-527) where carried out for morphological analysis of myotube number, area and diameter
for the 72-h data. Morphological analysis for the additional
24-h and 48-h data was also performed subsequently using
a general linear model (2 × 2 × 3) for time (0, 24 and 48 h),
glucose concentration (GR, DM) and resveratrol/EX-527
treatment (DM, RES, EX-527). Gene expression data for
both the 72-h and 24-h data were performed using a general
linear model (2 × 2 × 3) for time (0, 72 h or 0, 24 h), glucose
concentration (GR, DM) and resveratrol/EX-527 treatment
(DM, RES, EX-527). A general linear model for glucose
(LOW, NOR) and resveratrol/EX-527 treatment (DM, RES,
EX-527) was performed for phosphorylated protein activity. Relevant post hoc corrections tests were performed to
identify significant comparisons. Statistical significance was
at the level of p ≤ 0.05.
13
Molecular and Cellular Biochemistry (2018) 444:109–123
Results
The effect of resveratrol and glucose restriction
on myoblast differentiation and myotube
hypertrophy
SIRT1 is a histone deacetylase and phosphorylation
of SIRT1 is required to enable increases in deacetylase
activity [41]. Therefore, in order to first assess the optimal
dose of resveratrol and EX-527 in C2C12 cells, SIRT1
phosphorylation was assessed in DM control glucose
conditions. Indeed, SIRT1 phosphorylation increased on
average by 15-fold versus DM control when relativised to
total SIRT1 after 24-h administration of resveratrol. The
higher dose of 15 µM resveratrol showed no additional
increase versus 10 µM (where 5 µM resulted in no significant increase in SIRT1 phosphorylation) and higher doses
of 30 and 60 µM of resveratrol were cytotoxic and evoked
cell death (data not shown) as suggested in previous independent studies using these doses in C2C12 cells [33].
Following the addition of 100 nM EX-527, we observed
an average decrease of 71% in SIRT1 phosphorylation following 24 h in comparison to the DM control at 15 min,
compared to only a 50% reduction after 24 h in SIRT1
phosphorylation without EX-527 administration. Following these initial experiments, we next sought to assess the
role of glucose restriction alone on myoblast differentiation. Glucose restriction completely blocked differentiation in myoblasts demonstrated by no myotube formation
in these conditions (Fig. 1a). This corresponded with a significant reduction in myogenin gene expression at 72 h versus DM conditions (GR; 1.48 ± 1.53 vs. DM; 5.62 ± 4.12,
p = 0.047, Fig. 1b). This was associated with significant
increases in Sirt1 transcript expression in GR conditions
at 72 h (GR vs. DM: 2.97 ± 0.84 vs. 0.55 ± 0.23, p ≤ 0.05,
Fig. 1b), a similar finding to that demonstrated previously
upon blocking differentiation in the presence of the inflammatory cytokine TNF-α [16]. Resveratrol (10 μM) was
also unable to improve myogenin expression (data not presented) or prevent the block on morphological differentiation in GR conditions. Despite this, resveratrol improved
biochemical marker of differentiation, creatine kinase
(CK), in GR conditions at 7 days (GR: 16.82 ± 15.95 vs.
GR RES 54.4 ± 44.7 mU mg ml−1, p = 0.069; Fig. 1c),
albeit not quite attaining statistical significance. However, changes in CK activity were also temporally delayed,
where increases are usually observed 48–96 h post serum
withdrawal in normal glucose conditions [42–44]. Further, this non-significant increase in CK activity was
without improvement in morphological differentiation,
where CK levels did not approach those observed in DM
glucose conditions alone (281.5 ± 101.5 mU mg ml−1).
Molecular and Cellular Biochemistry (2018) 444:109–123
Fig. 1 a Glucose Restriction (GR) blocked differentiation in differentiating myoblasts with significant reductions in; b myogenin
and increases in Sirt1 gene expression. Resveratrol improved, c CK
activity in GR conditions # (albeit non-significantly p = 0.069), without improvements in differentiation. Resveratrol also improved, d, e
myotube area when glucose was more readily available in DM (differentiation media control) conditions at 7 days post induction of
differentiation. This was associated with increases in f Myhc7 and
115
Myhc4 coding for the slow type I and fast IIb MYHC protein isoforms. Further, EX-527 administration in DM conditions resulted in
reductions in g Myhc1 coding for IIx MYHC protein isoform with
this condition displaying the smallest mean myotube size versus all
other conditions. *Significantly different (p ≤ 0.05) versus DM conditions. **Significantly, (p ≤ 0.05) different versus EX-527 conditions.
All experiments are at least n = 3 in duplicate
13
116
13
Molecular and Cellular Biochemistry (2018) 444:109–123
Molecular and Cellular Biochemistry (2018) 444:109–123
◂Fig. 2 Loss of myotubes and reduced myotube growth occurred when
existing myotubes were placed in Glucose Restriction (GR) conditions for 72 h, demonstrated a morphologically and via reductions
in b myotube number, c myotube diameter and d myotube area. This
corresponded with reductions in gene expression of myotube maturation genes e Myhc1, 2, 4, 7, reductions in genes associated with
myofibre hypertrophy Igf-I, Igf-Ir and Igfbp2 and increased expression of genes associated with myotube atrophy/protein degradation,
Mafbx and Musa1. Resveratrol was unable to improve myotube survival or reduced myotube growth in GR conditions at 72 h however,
resveratrol evoked increases in f, h myotube area at 72 h when glucose was more readily available (DM/differentiation media control
conditions). This was associated with increases in i Igf-I and Myhc7
that codes for the slow type I Myhc protein isoform. EX-527 treatment also reduced g myotube number and h myotube area. This was
associated with reductions in gene expression of j Myhc 1, 2 and 4
coding for intermediate and IIx, IIa and IIb MYHC protein isoforms,
respectively. It is worth noting EX-527 administration evoked a similar 65–68% loss of myotubes experienced in GR conditions alone.
*Significantly different (p ≤ 0.05) versus DM 72-h conditions. All
experiments are at least n = 3 in duplicate
Further, resveratrol was unable to improve myotube number or diameter in DM conditions, however, did significantly improve myotube area after 7 days of differentiation versus DM alone and versus EX527 administration
(DM; 4551 ± 2836 μm2 vs. DM RES; 5718 ± 3532 μm2,
p = 0.044, vs. DM EX 527; 4142 ± 1873 μm2, p = 0.021,
Fig. 1d, e), suggesting an increase in myotube length
versus width. This was associated with a corresponding
increase in Myhc7 and Myhc4 coding for the slow type
I and fast IIb MYHC protein isoforms, respectively, in
resveratrol versus DM alone conditions (Myhc7: DM vs.
DM RES: 10.53 ± 9.84 vs. 77.5 ± 102.4, p = 0.002, Myhc4:
DM vs. DM RES: 67.9 ± 19.2 vs. 172.4 ± 111.8, p < 0.001,
Fig. 1f). Furthermore, EX-527 administration resulted in
reductions in Myhc1 coding for intermediate IIx MYHC
protein isoform (DM vs. DM EX527: 212.4 ± 120.4 vs.
123 ± 124, p = 0.008, Fig. 1g), with this condition displaying the smallest mean myotube size (4142 ± 1873 μm 2,
Fig. 1e). Overall, resveratrol treatment in normal glucose
conditions evoked higher gene expression associated with
a slow and fast fibre formation and EX-527 administration
resulted in lower gene expression associated with intermediate fibre formation. However, resveratrol treatment
was unable to prevent the complete block on differentiation, despite improved CK activity, in glucose-restricted
conditions.
Resveratrol was unable to prevent reduced
myotube growth in glucose restriction conditions
yet improved myotube hypertrophy when glucose
was available
Since resveratrol induced changes in Myhc gene expression
were at later time points of differentiation in myoblasts, we
117
decided to investigate the role of resveratrol and EX-527
treatment in both DM and glucose restriction (GR) conditions in existing myotubes (already matured for 7 days).
Firstly, we confirmed that GR alone evoked a considerable reduction in myotube number (DM 9 ± 2.85 vs. GR
5.38 ± 2.28, p ≤ 0.05, Fig. 2a, b), and reduced myotube
growth demonstrated by reductions in myotube diameter (DM 15.56 ± 5.38 vs. GR 12.1 ± 4.453 μm, p ≤ 0.05,
Fig. 2a, c) and area (DM 3820 ± 2625 vs. GR 2897 ± 2024
μm2, p ≤ 0.05, Fig. 2 a, d) in existing myotubes after 72-h
glucose restriction. These morphological observations
were confirmed in GR alone versus DM conditions, where
lower gene expression of myotube maturation genes Myhc1,
2, 4, 7 (Myhc1: DM 3.2 ± 0.4 vs. GR 1.2 ± 0.29; Myhc2:
1.86 ± 0.28 vs. GR 0.39 ± 0.13; Myhc4: DM 4.19 ± 1.87 vs.
GR 0.92 ± 0.31; Myhc7: DM 4.32 ± 1.39 vs. GR 1.06 ± 0.3,
all p ≤ 0.05, Fig. 2e), and genes associated with myotube
hypertrophy were observed (Igf-I; Igf-Ir and Igfbp2 (Igf-I:
DM 1.59 ± 0.32 vs. GR 0.05 ± 0.01; Igf-Ir: DM 0.97 ± 0.1 vs.
GR 0.64 ± 0.06; Igfbp2: DM 1.14 ± 0.32 vs. GR 0.43 ± 0.05,
all p ≤ 0.05, Fig. 2e). This also was associated with higher
expression of genes associated with protein degradation
such as Mafbx and Musa1 (Mafbx: DM 0.7 ± 0.14 vs. GR
0.93 ± 0.27; Musa1: DM 0.74 ± 0.1 vs. GR 1.09 ± 0.13, all
p ≤ 0.05, Fig. 2e). No changes were observed in gene expression of Igf-II, Igf-IIr, Mtor, Tnf-α, Tnfrsflb, Myostatin, Murf,
Fox01, Fox03, Nf-kb, p53 or Sirt1 (data not shown). Resveratrol did not prevent the reductions in myotube growth in GR
conditions, however importantly, resveratrol administration
was able to promote significant increases in myotube hypertrophy at 72 h when added to existing myotubes after 7 days
of differentiation in DM conditions (DM; 3785 ± 2542 vs.
DM RES 4088 ± 2728 μm2, p = 0.05, Fig. 2f, h). This corresponded with significant increases in the expression of
genes associated with myotube hypertrophy such as Igf-I
(DM; 1.61 ± 0.40 vs. DM RES; 2.12 ± 0.20, p = 0.033;
Fig. 2i) (with no change in Igf-Ir, IGF-II, Igf-IIr, or Mtor)
and Myhc7, that codes for the slow type I Myhc protein isoform (DM; 3.08 ± 0.81 vs. DM RES; 4.20 ± 0.82, p = 0.002,
Fig. 2i). Resveratrol however, did not affect expression of
genes associated with myotube atrophy/protein degradation
(Tnf-α, Tnfrsf1b, Myostatin, Murf, Mafbx, Musa1, Fox-01,
3, Nf-kb, p53, data not shown) in this condition. Alternatively, EX-527 treatment (100 nM) also reduced myotube
number, an observation that approached significance (DM
9.00 ± 2.59 vs. DM EX-527 5.62 ± 2.94, p = 0.073, Fig. 2g),
and myotube area at 72 h (DM 3785 ± 2542 vs. DM EX-527;
3433 ± 2394 μM2, p = 0.026, Fig. 2h). Indeed, the loss of
myotube number with EX-527 administration at 72 h in
high-glucose conditions was similar to the loss observed
in GR conditions alone, confirmed by no significant difference between these conditions (DM EX-527 5.62 ± 2.94
vs. GR 5.38 ± 2.28, p = N.S.) and both GR and DM EX-527
13
118
conditions exhibited a similar ~ 65% reduction in myotubes
vs. 0 h controls (0 h, 8.25 ± 2.85 vs. DM EX-527 5.62 ± 2.94
(65% reduction) vs. GR 5.38 ± 2.28 (68% reduction), both
comparisons p ≤ 0.001, Fig. 2g). In these conditions where
EX-527 was administered yet glucose was more readily
available, there were also reductions in gene expression of
Myhc 1, 2 and 4 coding for intermediate/faster IIx, IIa and
IIb protein isoforms, respectively, (Myhc1; DM 3.39 ± 1.38
vs. DM EX-527 2.26 ± 0.69, p = 0.09: Myhc2; DM
1.86 ± 0.41 vs. DM EX-527 1.55 ± 0.08, p = 0.034: Myhc4;
DM 4.52 ± 2.83 vs. DM EX-527 2.72 ± 0.74, p = 0.058
(Fig. 2i). Overall, these data suggest that where glucose was
readily available, resveratrol and EX-527 promoted myotube
hypertrophy and reduced growth, respectively. Furthermore,
resveratrol administration regulated Myhc genes towards a
‘slower’ fibre-type expression profile vs. a reduced intermediate/faster expression profile in the presence of EX-527.
Finally, in these conditions, EX-527 administration evoked
a similar 65% loss of myotubes, also experienced in GR
conditions alone.
Resveratrol administration acutely negated reduced
myotube growth during glucose restriction
Importantly, resveratrol treatment in existing myotubes
under GR conditions for 24 h was also able to improve
myotube hypertrophy (Fig. 3a) demonstrated by significant
improvements in myotube area (GR 2635.30 ± 1524.10 vs.
GR RES: 3474.00 ± 2235.00 μM2, p < 0.001, Fig. 3b). However, this was without changes in Myhc gene expression profiles as observed above in DM conditions (data not shown).
Despite this improvement after 24 h, resveratrol was unable
to improve myotube size in GR conditions at 72 h when
administered to existing myotubes (data not shown). Therefore, a single dose of resveratrol had a role in acutely (for
24 h) negating the effect of reduced myotube growth in vitro
when modelling interstitial glucose levels of CR in vivo.
Fig. 3 Resveratrol was able to
improve a, b myotube area for
a period of 24 h after dosing in
Glucose Restriction (GR) conditions. *Significantly different
(p ≤ 0.05) versus GR conditions
alone. All experiments are at
least n = 3 in duplicate
13
Molecular and Cellular Biochemistry (2018) 444:109–123
Finally, because of the improvements in myotube size over
an acute 24-h period with resveratrol treatment in GR conditions yet without alterations in gene expression of myosin
heavy chains, alterations in more acutely and transiently
regulated cell signalling activity of energy-sensing protein
(AMPK) and protein translation initiator (P70S6K) were
assessed at 15, 30 min, 2 and 24 h in GR and DM conditions in the absence and presence of resveratrol and EX-527.
Indeed, it has previously been shown that AMPK increases
following starvation and suppresses activity of protein synthetic signalling (P70S6K) [24]. Resveratrol did not alter the
activity of energy-dependent sensing protein AMPK or protein translation initiator P70S6K in glucose-restricted conditions (data not shown). However, EX-527 administration on
average increased (approaching significance) AMPK phosphorylation at 30 min in DM glucose conditions (30 min;
DM 1.00 ± 0.63 vs. DM EX-527 2.63 ± 1.66, p = 0.066, 2 h
DM vs. DM EX-527: 1.00 ± 0.36 vs. 2.24 ± 1.45, p = 0.086)
and 24 h (DM vs. DM EX-527: 1.00 ± 0.43 vs. 2.61 ± 0.75,
p = 0.069; Fig. 4a, b). Increases in AMPK with EX-527 in
DM glucose conditions also led to a non-significant reduction in protein activity of P70S6K at 30 min versus DM
alone (DM vs. DM EX-527: 1.00 ± 0.56 vs. 0.76 ± 0.15,
p = N.S). However, similar non-significant reductions were
observed with resveratrol treatment. Overall, these signalling data perhaps suggest that adequate Sirtuin activity is
required to enable normal AMPK signalling with normal
glucose availability; however, resveratrol did not increase
P70S6K signalling in either GR or DM conditions.
Summary/discussion
In the present study, we hypothesised that resveratrol treatment in skeletal muscle cells would attenuate loss of differentiation and reduced myotube size in both regenerating myoblasts and existing mature myotubes, respectively,
Molecular and Cellular Biochemistry (2018) 444:109–123
Fig. 4 Resveratrol treatment did not alter the activity of energydependent sensing protein AMPK or protein translation initiator
P70s6K in Glucose Restriction (GR) conditions over 24 h. However, EX-527 treatment on average increased a, b (approached significance) AMPK activity at 30 min and 24 h in DM (differentiation
media control) conditions (level of significance depicted on Fig. 2b).
All experiments are at least n = 3
during glucose restriction. This hypothesis however was
partly rejected because, despite confirming increased SIRT1
phosphorylation with resveratrol administration in DM conditions, we were unable to prevent the block on differentiation in myoblasts caused by GR conditions in the presence
of resveratrol (10 µM). Importantly however, resveratrol was
able to evoke increases in myotube area of differentiating
myoblasts under DM glucose conditions with corresponding
increases in both Myhc7 and 4 coding for the both slow type
I and fast IIb Myhc protein isoforms, respectively. Our original hypothesis however could be partly accepted in experiments undertaken at more acute time points in mature myotubes. Resveratrol treatment in mature myotubes under GR
conditions was able to improve myotube hypertrophy over
an acute 24-h period, but not over 48–72 h. However, this
observation was without changes in Myhc gene expression
profiles as previously observed in DM conditions where glucose was available with resveratrol treatment. This suggested
that a single dose of resveratrol played a role in acutely (for
24 h) negating the effect of reduced myotube growth when
modelling in vitro interstitial glucose-restricted levels during CR in vivo. Despite this, resveratrol did not appear to
modulate phosphorylation of energy-sensing protein AMPK
or protein translation initiator P70S6K in these myotubes.
EX-527 (SIRT1 inhibitor) administration did however,
increase average AMPK phosphorylation in both GR and
DM (that approached significance) glucose conditions with
a corresponding average, yet non-significant suppression of
P70S6K in DM glucose conditions. Finally, in myotubes at
later time points (72 h) where glucose was readily available,
119
resveratrol treatment promoted myotube hypertrophy and
regulated Myhc7 genes towards ‘slower’ fibre type expression profiles, with SIRT1 inhibition via EX-527 administration also causing a reduction in Myhc 1, 2 and 4 coding
for intermediate and faster IIx, IIa and IIb protein isoforms,
respectively.
Previous studies have suggested that total MYHC
protein and myotube size (diameter) are increased when
glucose is readily available in the presence of 20 µM resveratrol [45]. Other studies have suggested that overexpression of SIRT1 in mouse and human skeletal muscle
cells, impairs differentiation and myosin heavy chain
production, however, if SIRT1 is decreased then muscle
cells differentiate prematurely [46, 47]. Furthermore, an
increase in proliferation, inhibition of p21cip and p27kip
(cyclin-dependent kinase inhibitors important for cell
cycle exit in G1 in order to enable myoblast fusion) caused
a reduction in differentiation following SIRT1 overexpression in rat myoblasts [48]. These studies would therefore
somewhat disagree with the present investigation. However, more recently it has been suggested that a resveratrol
concentration of 10 µM (the same as the present study)
increased the percentage of cells in the G1 phase cell
cycle exit required for myoblast differentiation [33]. The
present study consolidated the role of increased SIRT1
phosphorylation in differentiating myoblasts via resveratrol treatment when glucose is readily available via the
regulation of increases in Myhc gene expression (slow and
fast) and increased myotube size, together with increases
in slow Myhc gene expression in myotubes. Furthermore,
SIRT1 inhibition via EX-527 administration resulted in
reductions in intermediate (in myoblasts) and intermediate/fast (in myotubes) Myhc gene expression, suggesting
that normal SIRT1 activity is perhaps required to maintain adequate intermediate to fast Myhc gene expression.
Indeed, previous studies have suggested that transgenic
overexpression of SIRT1 evokes a slow phenotype in mice
[49]. Due to this interesting finding, future studies may
wish to investigate the role of SIRT1 activation/inhibition
on Nuclear factor of activated T-cells (NFAT) activity in
skeletal muscle cells. As this transcription factor regulates
the activation of muscle fibre genes associated with the
characterization of ‘slow’ and ‘fast’ myofibres [50], and is
known to be transcriptionally suppressed by SIRT1 [51].
Finally, if extrapolating to the potential use of resveratrol in elderly populations in vivo to attenuate age-related
muscle loss (sarcopenia). Sarcopenia is characterised by a
more predominant loss of type II fibres [52] and therefore
is a contributing factor to reductions in maximum strength
with age (reviewed in [53]). Data herein suggest resveratrol treatment, although resulting in increased myofibre
size, these fibres may be slower in fibre composition which
may not be advantageous in terms of force production,
13
120
but perhaps may contribute to improvements in metabolic
health in vivo [54].
As discussed above, although resveratrol treatment was
unable to restore blocked differentiation in myoblasts under
GR conditions, resveratrol was able to improve myotube
diameter and area in GR compared with GR alone conditions
in mature myotubes over an acute period of 24 h. However,
this finding did not continue over the remaining time course
(48–72 h) where myotubes were then lost (reduced number)
under GR conditions even in the presence of the resveratrol.
The improvement in myotube size at 24 h with resveratrol
in GR conditions were not driven by changes in Myhc gene
expression, as was the case in control conditions where glucose was more readily available. From these findings, we can
infer that the reduced myotube growth experienced under
GR conditions may be attenuated following a single dose
of resveratrol over a 24-h time period. However, repeated
doses may be required to maintain myotube hypertrophy
in vitro over a longer time period under GR conditions.
Yet, this approach in vivo requires further investigation,
due to altered pharmacokinetics and high absorption, yet
low bioavailability through the gut after oral administration [55]. Due to no changes in Myhc gene expression at an
acute time point of 24 h in myotubes under GR conditions
in the presence of resveratrol, yet an increase in myotube
size was observed; we investigated more acute and transient
mechanisms of intracellular signalling of protein synthetic
translation initiator P70S6K at 15, 30 min, 2 and 24 h after
dosing. Furthermore, because glucose restriction in skeletal
muscle cells has been shown to increase activity of AMPK
[47] and can suppress growth-related signalling of P70S6K
via TSC2 inhibition of mTOR [24], we also investigated
AMPK signalling at the same time points. Despite this, there
were no changes in phosphorylation of AMPK or P70S6K
in GR or DM conditions with resveratrol versus relevant
control conditions. However, we did observe a trend towards
increased AMPK following EX-527 administration, which
approached significance in DM conditions together with
average but non-significant reduction in P70S6K, where
in this condition there was a corresponding suppression
of intermediate/fast Myhc gene expression and myotube
hypertrophy. Additionally, we observed increased AMPK
with EX-527 treatment in glucose-restricted conditions in
comparison with resveratrol conditions, yet the increase
was not significantly increased versus DM conditions and
no corresponding changes in P70S6K were observed. These
data suggest that only SIRT1 inhibition via EX-527 administration was able to moderately increase AMPK activity in
both glucose conditions. Therefore, normal SIRT1 activity
may be required for adequate AMPK activity to prevent the
suppression of P70S6K and the corresponding reductions
in myotube size observed in SIRT1 inhibitor conditions.
13
Molecular and Cellular Biochemistry (2018) 444:109–123
Despite this, the mechanisms responsible for the increased
myotube hypertrophy following resveratrol administration at
24 h in GR conditions were not attributable to alterations in
energy sensing signalling and/or protein synthetic signalling.
Indeed, previous literature has suggested that SIRT1 activation in myoblasts has been shown to inhibit Akt and leucine
evoked increases in mTOR [56]. Alternatively, SIRT1 and
2 have also been previously shown to deacetylate mTOR
at Thr-389 with acetylation blocking P70S6K activation
and, therefore, deacetylation; resulting in phosphorylation
of P70S6K [57]. Furthermore, albeit in cardiac muscle,
SIRT1 has been shown to deacetylate Akt and PDK which
allows binding to phosphatidylinositol 3,4,5-trisphosphate
(PIP(3)), its relocation to the membrane where PDK enables Akt phosphorylation upstream of P70S6K [58]. These
later studies are in contrast in the present study where we
found no effect of manipulating SIRT activation (assessed by
phosphorylation) via resveratrol on P70S6K activity. However, the present study did not assess SIRT1’s deacetylation
function, and while phosphorylation of SIRT1 is required to
enable increases in deacetylase activity [41], this warrants
further investigation. The present study extends the work
above by including inhibition of SIRT1 phosphorylation
by EX-527, which suggests that normal SIRT1 activity was
required to enable adequate AMPK signalling.
Conclusion
We originally hypothesised that resveratrol treatment
would improve differentiation and myotube hypertrophy in
differentiating myoblasts, and prevent myotube atrophy in
mature differentiated myotubes during glucose restriction
(GR). Resveratrol treatment did not improve myoblast differentiation in GR conditions; however, improved hypertrophy of mature myotubes when glucose was available via
regulation of slow Mhyc gene expression and acutely (for
24 h) maintained myotube size when modelling interstitial
low glucose levels mimicking in vivo calorie restriction.
Repeated administration of resveratrol every 24 h may
therefore be advantageous in vitro during glucose restriction; however, this requires investigation in mammalian
models to take into account of altered pharmacokinetics
and bioavailability in vivo.
Acknowledgements This research was funded by a Grant to PI Adam
P. Sharples from The Physiological Society, UK.
Compliance with ethical standards
Conflict of interest The authors have no conflicts of interest to declare.
Molecular and Cellular Biochemistry (2018) 444:109–123
Ethical approval The studies did not involve human participants or
animals (only cell lines) and therefore studies did not require ethical
approval or informed consent to undertake.
Open Access This article is distributed under the terms of the Creative
Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate
credit to the original author(s) and the source, provide a link to the
Creative Commons license, and indicate if changes were made.
References
1. Sharples AP, Hughes DC, Deane CS, Saini A, Selman C,
Stewart CE (2015) Longevity and skeletal muscle mass: the
role of IGF signalling, the sirtuins, dietary restriction and protein intake. Aging Cell 14:511–523. https://doi.org/10.1111/
acel.12342
2. Willett M, Cowan JL, Vlasak M, Coldwell MJ, Morley SJ (2009)
Inhibition of mammalian target of rapamycin (mTOR) signalling
in C2C12 myoblasts prevents myogenic differentiation without
affecting the hyperphosphorylation of 4E-BP1. Cell Signal
21:1504–1512. https://doi.org/10.1016/j.cellsig.2009.05.009
3. Goodman CA, Frey JW, Mabrey DM, Jacobs BL, Lincoln HC,
You JS, Hornberger TA (2011) The role of skeletal muscle mTOR
in the regulation of mechanical load-induced growth. J Physiol
589:5485–5501. https://doi.org/10.1113/jphysiol.2011.218255
4. Risson V, Mazelin L, Roceri M, Sanchez H, Moncollin V, Corneloup C, Richard-Bulteau H, Vignaud A, Baas D, Defour A,
Freyssenet D, Tanti JF, Le-Marchand-Brustel Y, Ferrier B, Conjard-Duplany A, Romanino K, Bauche S, Hantai D, Mueller M,
Kozma SC, Thomas G, Ruegg MA, Ferry A, Pende M, Bigard
X, Koulmann N, Schaeffer L, Gangloff YG (2009) Muscle inactivation of mTOR causes metabolic and dystrophin defects leading to severe myopathy. J Cell Biol 187:859–874. https://doi.
org/10.1083/jcb.200903131
5. Ohanna M, Sobering AK, Lapointe T, Lorenzo L, Praud C,
Petroulakis E, Sonenberg N, Kelly PA, Sotiropoulos A, Pende
M (2005) Atrophy of S6K1(-/-) skeletal muscle cells reveals
distinct mTOR effectors for cell cycle and size control. Nat Cell
Biol 7:286–294. https://doi.org/10.1038/ncb1231
6. Aguilar V, Alliouachene S, Sotiropoulos A, Sobering A, Athea Y,
Djouadi F, Miraux S, Thiaudiere E, Foretz M, Viollet B, Diolez P,
Bastin J, Benit P, Rustin P, Carling D, Sandri M, Ventura-Clapier
R, Pende M (2007) S6 kinase deletion suppresses muscle growth
adaptations to nutrient availability by activating AMP kinase. Cell
Metab 5:476–487. https://doi.org/10.1016/j.cmet.2007.05.006
7. Coolican SA, Samuel DS, Ewton DZ, McWade FJ, Florini JR
(1997) The mitogenic and myogenic actions of insulin-like
growth factors utilize distinct signaling pathways. J Biol Chem
272:6653–6662
8. Lawlor MA, Feng X, Everding DR, Sieger K, Stewart CE, Rotwein
P (2000) Dual control of muscle cell survival by distinct growth
factor-regulated signaling pathways. Mol Cell Biol 20:3256–3265
9. Mercken EM, Crosby SD, Lamming DW, JeBailey L, KrzysikWalker S, Villareal DT, Capri M, Franceschi C, Zhang Y,
Becker K, Sabatini DM, de Cabo R, Fontana L (2013) Calorie restriction in humans inhibits the PI3K/AKT pathway and
induces a younger transcription profile. Aging Cell 12:645–651.
https://doi.org/10.1111/acel.12088
10. Edstrom E, Altun M, Hagglund M, Ulfhake B (2006) Atrogin-1/
MAFbx and MuRF1 are downregulated in aging-related loss of
skeletal muscle. J Gerontol A Biol Sci Med Sci 61:663–674
121
11. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A,
Walsh K, Schiaffino S, Lecker SH, Goldberg AL (2004) Foxo
transcription factors induce the atrophy-related ubiquitin ligase
atrogin-1 and cause skeletal muscle atrophy. Cell 117:399–412
12. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke
BA, Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan
ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD,
Glass DJ (2001) Identification of ubiquitin ligases required for
skeletal muscle atrophy. Science 294:1704–1708
13. Morris BJ (2013) Seven sirtuins for seven deadly diseases of
aging. Free Radic Biol Med 56:133–171
14. Lee D, Goldberg AL (2013) SIRT1 protein, by blocking the
activities of transcription factors FoxO1 and FoxO3, inhibits
muscle atrophy and promotes muscle growth. J Biol Chem
288:30515–30526
15. Saini A, Al-Shanti N, Faulkner SH, Stewart CE (2008) Pro- and
anti-apoptotic roles for IGF-I in TNF-alpha-induced apoptosis: a
MAP kinase mediated mechanism. Growth Factors 26:239–253
16. Saini A, Al-Shanti N, Sharples AP, Stewart CE (2012) Sirtuin 1
regulates skeletal myoblast survival and enhances differentiation
in the presence of resveratrol. Exp Physiol 97:400–418. https://
doi.org/10.1113/expphysiol.2011.061028
17. Wang L, Zhang T, Xi Y, Yang C, Sun C, Li D (2016) Sirtuin 1 promotes the proliferation of C2C12 myoblast cells via the myostatin
signaling pathway. Mol Med Rep 14:1309–1315
18. Miller RA, Harrison DE, Astle CM, Baur JA, Boyd AR, de Cabo
R, Fernandez E, Flurkey K, Javors MA, Nelson JF, Orihuela CJ,
Pletcher S, Sharp ZD, Sinclair D, Starnes JW, Wilkinson JE,
Nadon NL, Strong R (2011) Rapamycin, but not resveratrol or
simvastatin, extends life span of genetically heterogeneous mice. J
Gerontol A Biol Sci Med Sci 66:191–201. https://doi.org/10.1093/
gerona/glq178
19. Pearson KJ, Baur JA, Lewis KN, Peshkin L, Price NL, Labinskyy
N, Swindell WR, Kamara D, Minor RK, Perez E, Jamieson HA,
Zhang Y, Dunn SR, Sharma K, Pleshko N, Woollett LA, Csiszar
A, Ikeno Y, Le Couteur D, Elliott PJ, Becker KG, Navas P, Ingram
DK, Wolf NS, Ungvari Z, Sinclair DA, de Cabo R (2008) Resveratrol delays age-related deterioration and mimics transcriptional
aspects of dietary restriction without extending life span. Cell
Metab 8:157–168. https://doi.org/10.1016/j.cmet.2008.06.011
20. Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra
A, Prabhu VV, Allard JS, Lopez-Lluch G, Lewis K, Pistell PJ,
Poosala S, Becker KG, Boss O, Gwinn D, Wang M, Ramaswamy
S, Fishbein KW, Spencer RG, Lakatta EG, Le Couteur D, Shaw
RJ, Navas P, Puigserver P, Ingram DK, de Cabo R, Sinclair DA
(2006) Resveratrol improves health and survival of mice on a
high-calorie diet. Nature 444:337–342. https://doi.org/10.1038/
nature05354
21. Martinez JA, Navas-Carretero S, Saris WHM, Astrup A (2014)
Personalized weight loss strategies[mdash]the role of macronutrient distribution. Nat Rev Endocrinol 10:749–760. https://doi.
org/10.1038/nrendo.2014.175
22. Anderson RM, Bitterman KJ, Wood JG, Medvedik O, Sinclair DA
(2003) Nicotinamide and PNC1 govern lifespan extension by calorie restriction in Saccharomyces cerevisiae. Nature 423:181–185.
https://doi.org/10.1038/nature01578
23. Li Y, Liu L, Tollefsbol TO (2010) Glucose restriction can extend
normal cell lifespan and impair precancerous cell growth through
epigenetic control of hTERT and p16 expression. FASEB J
24:1442–1453. https://doi.org/10.1096/fj.09-149328
24. Inoki K, Zhu T, Guan K-L (2003) TSC2 mediates cellular energy
response to control cell growth and survival. Cell 115:577–590.
https://doi.org/10.1016/S0092-8674(03)00929-2
25. Elkalaf M, Anděl M, Trnka J (2013) Low glucose but not galactose enhances oxidative mitochondrial metabolism in C2C12
13
122
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
Molecular and Cellular Biochemistry (2018) 444:109–123
myoblasts and myotubes. PLoS One 8:e70772. https://doi.
org/10.1371/journal.pone.0070772
Khodabukus A, Baar K (2015) Glucose concentration and streptomycin alter in vitro muscle function and metabolism. J Cell
Physiol 230:1226–1234
Walford RL, Harris SB, Gunion MW (1992) The calorically
restricted low-fat nutrient-dense diet in Biosphere 2 significantly
lowers blood glucose, total leukocyte count, cholesterol, and blood
pressure in humans. Proc Natl Acad Sci USA 89:11533–11537
Cartee G, Kietzke E, Briggs-Tung C (1994) Adaptation of muscle
glucose transport with caloric restriction in adult, middle-aged,
and old rats. Am J Physiol 266:R1443–R1447
Aussedat B, Dupire-Angel M, Gifford R, Klein J, Wilson G, Reach
G (2000) Interstitial glucose concentration and glycemia: implications for continuous subcutaneous glucose monitoring. Am J
Physiol 278:E716–E728
Maggs D, Jacob R, Rife F, Lange R, Leone P, During M, Tamborlane W, Sherwin R (1995) Interstitial fluid concentrations of
glycerol, glucose, and amino acids in human quadricep muscle
and adipose tissue. Evidence for significant lipolysis in skeletal
muscle. J Clin Investig 96:370
Liu M, Wilk SA, Wang A, Zhou L, Wang R-H, Ogawa W, Deng
C, Dong LQ, Liu F (2010) Resveratrol inhibits mTOR Signaling by promoting the interaction between mTOR and DEPTOR.
J Biol Chem 285:36387–36394. https://doi.org/10.1074/jbc.
M110.169284
Kaminski J, Lançon A, Aires V, Limagne E, Tili E, Michaille J-J,
Latruffe N (2012) Resveratrol initiates differentiation of mouse
skeletal muscle-derived C2C12 myoblasts. Biochem Pharmacol
84:1251–1259. https://doi.org/10.1016/j.bcp.2012.08.023
Bosutti A, Degens H (2015) The impact of resveratrol and hydrogen peroxide on muscle cell plasticity shows a dose-dependent
interaction. Sci Rep 5:8093. https://doi.org/10.1038/srep08093
Ito-Nagahata T, Kurihara C, Hasebe M, Ishii A, Yamashita K,
Iwabuchi M, Sonoda M, Fukuhara K, Sawada R, Matsuoka A,
Fujiwara Y. Bioscience (2013) Stilbene analogs of resveratrol
improve insulin resistance through activation of AMPK. Biotechnol Biochem 77:1229–1235. https://doi.org/10.1271/bbb.121000
Blau HM, Pavlath GK, Hardeman EC, Chiu C-P, Silberstein L,
Webster SG, Miller SC, Webster C (1985) Plasticity of the differentiated state. Science 230:758–766
Deane CS, Hughes DC, Sculthorpe N, Lewis MP, Stewart
CE, Sharples AP (2013) Impaired hypertrophy in myoblasts is
improved with testosterone administration. J Steroid Biochem Mol
Biol 138:152–161. https://doi.org/10.1016/j.jsbmb.2013.05.005
Hughes DC, Stewart CE, Sculthorpe N, Dugdale HF, Yousefian
F, Lewis MP, Sharples AP (2016) Testosterone enables growth
and hypertrophy in fusion impaired myoblasts that display
myotube atrophy: deciphering the role of androgen and IGF-I
receptors. Biogerontology 17:619–639. https://doi.org/10.1007/
s10522-015-9621-9
Girven M, Dugdale HF, Owens DJ, Hughes DC, Stewart CE,
Sharples AP (2016) l-glutamine improves skeletal muscle cell
differentiation and prevents myotube atrophy after cytokine (TNFalpha) stress via reduced p38 MAPK signal transduction. J Cell
Physiol. https://doi.org/10.1002/jcp.25380
Yang S, Alnaqeeb M, Simpson H, Goldspink G (1996) Cloning
and characterization of an IGF-1 isoform expressed in skeletal
muscle subjected to stretch. J Muscle Res Cell Motil 17:487–495
Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data
by the comparative CT method. Nat Protocols 3:1101–1108
Sasaki T, Maier B, Koclega KD, Chruszcz M, Gluba W, Stukenberg PT, Minor W, Scrable H (2008) Phosphorylation regulates
SIRT1 function. PloS ONE 3:e4020
Sharples AP, Al-Shanti N, Hughes DC, Lewis MP, Stewart CE
(2013) The role of insulin-like-growth factor binding protein
13
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
2 (IGFBP2) and phosphatase and tensin homologue (PTEN)
in the regulation of myoblast differentiation and hypertrophy.
Growth Horm IGF Res 23:53–61. https://doi.org/10.1016/j.
ghir.2013.03.004
Sharples AP, Al-Shanti N, Lewis MP, Stewart CE (2011) Reduction of myoblast differentiation following multiple population
doublings in mouse C(2) C(12) cells: a model to investigate ageing? J Cell Biochem 112:3773–3785. https://doi.org/10.1002/
jcb.23308
Sharples AP, Al-Shanti N, Stewart CE (2010) C2 and C2C12
murine skeletal myoblast models of atrophic and hypertrophic
potential: relevance to disease and ageing? J Cell Physiol
225:240–250. https://doi.org/10.1002/jcp.22252
Montesano A, Luzi L, Senesi P, Mazzocchi N, Terruzzi
I (2013) Resveratrol promotes myogenesis and hypertrophy in murine myoblasts. J Transl Med 11:310. https://doi.
org/10.1186/1479-5876-11-310
Fulco M, Schiltz RL, Iezzi S, King MT, Zhao P, Kashiwaya Y,
Hoffman E, Veech RL, Sartorelli V (2003) Sir2 regulates skeletal
muscle differentiation as a potential sensor of the redox state. Mol
Cell 12:51–62
Fulco M, Cen Y, Zhao P, Hoffman EP, McBurney MW, Sauve AA,
Sartorelli V (2008) Glucose restriction inhibits skeletal myoblast
differentiation by activating SIRT1 through AMPK-mediated regulation of Nampt. Dev Cell 14:661–673. https://doi.org/10.1016/j.
devcel.2008.02.004
Rathbone CR, Booth FW, Lees SJ (2009) Sirt1 increases skeletal
muscle precursor cell proliferation. Eur J Cell Biol 88:35–44
Chalkiadaki A, Igarashi M, Nasamu AS, Knezevic J, Guarente L
(2014) Muscle-specific SIRT1 gain-of-function increases slowtwitch fibers and ameliorates pathophysiology in a mouse model
of duchenne muscular dystrophy. PLoS Genet 10:e1004490.
https://doi.org/10.1371/journal.pgen.1004490
Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, Wu H, Zhu W, Bassel-Duby R, Williams RS (1998) A
calcineurin-dependent transcriptional pathway controls skeletal
muscle fiber type. Genes Develop 12:2499–2509
Jia Y-Y, Lu J, Huang Y, Liu G, Gao P, Wan Y-Z, Zhang R, Zhang
Z-Q, Yang R-F, Tang X (2014) The involvement of NFAT transcriptional activity suppression in SIRT1-mediated inhibition
of COX-2 expression induced by PMA/Ionomycin. PloS ONE
9:e97999
Nilwik R, Snijders T, Leenders M, Groen BB, van Kranenburg J,
Verdijk LB, van Loon LJ (2013) The decline in skeletal muscle
mass with aging is mainly attributed to a reduction in type II muscle fiber size. Exp Gerontol 48:492–498. https://doi.org/10.1016/j.
exger.2013.02.012
Deschenes MR (2004) Effects of aging on muscle fibre type and
size. Sports Med 34:809–824
Schenk S, McCurdy CE, Philp A, Chen MZ, Holliday MJ, Bandyopadhyay GK, Osborn O, Baar K, Olefsky JM (2011) Sirt1
enhances skeletal muscle insulin sensitivity in mice during caloric
restriction. J Clin Invest 121:4281–4288. https://doi.org/10.1172/
jci58554
Walle T, Hsieh F, DeLegge MH, Oatis JE, Walle UK (2004)
High absorption but very low bioavailability of oral resveratrol
in humans. Drug Metabol Dispos 32:1377–1382
Liu M, Wilk SA, Wang A, Zhou L, Wang RH, Ogawa W, Deng
C, Dong LQ, Liu F (2010) Resveratrol inhibits mTOR signaling by promoting the interaction between mTOR and DEPTOR.
J Biol Chem 285:36387–36394. https://doi.org/10.1074/jbc.
M110.169284
Hong S, Zhao B, Lombard DB, Fingar DC, Inoki K (2014) Crosstalk between sirtuin and mammalian target of rapamycin complex
1 (mTORC1) signaling in the regulation of S6 kinase 1 (S6K1)
Molecular and Cellular Biochemistry (2018) 444:109–123
phosphorylation. J Biol Chem 289:13132–13141. https://doi.
org/10.1074/jbc.M113.520734
58. Sundaresan NR, Pillai VB, Wolfgeher D, Samant S, Vasudevan P,
Parekh V, Raghuraman H, Cunningham JM, Gupta M, Gupta MP
(2011) The deacetylase SIRT1 promotes membrane localization
123
and activation of Akt and PDK1 during tumorigenesis and cardiac hypertrophy. Sci Signal 4:ra46. https://doi.org/10.1126/
scisignal.2001465
13