← Back
Synthesis and biological evaluation of zwitterionic half-sandwich Rhodium(III) and Ruthenium(II) organometallic complexes.
Cellular and Molecular Biology
E-ISSN : 1165-158X / P-ISSN : 0145-5680
www.cellmolbiol.org
Effect of Gushen shetuo decoction in improving motor and non-motor symptoms and the
expression of PERK, ATF4 and CHOP in patients with Parkinson's disease
Peishan Li1,2, Ning Yang2#*, Weifeng Guo1#*, Houxu Ning2, Weihao Cheng2, Haidong Wang2
First Clinical Medical College, Nanjing University of Chinese Medicine, Nanjing, Jiangsu, 210023, China
Department of Traditional Chinese Medicine, Affiliated Nanjing Brain Hospital, Nanjing Medical University, Nanjing, Jiangsu, 210029, China
1
2
#
Contributed equally to this work.
ARTICLE INFO
ABSTRACT
This study aims to observe the therapeutic effect of Gushen Shetuo decoction on Parkinson's disease (PD),
so as to provide reference for clinical practice. In order to demonstrate the clinical value of Gushen Shetuo
Decoction, we selected 80 patients with PD for the study. Among them, 38 patients received the Gushen SheArticle history:
tuo decoction (research group), and 42 patients received Levodopa and Benserazide Hydrochloride Tablets
Received: July 02, 2023
(control group). There was no difference in Non-Motor Symptoms Scale (NMSS) scores between the research
Accepted: September 24, 2023
group and the control group (P>0. 05). However, the scores of motor complications in Movement Disorder
Published: December 10, 2023
Society-sponsored revision of the Parkinson's Disease Rating Scale (MDS-UPDRS) and those of Drooling SeKeywords:
verity and Frequency Scale (DSFS) in the research group were lower than those in the control group (P<0. 05).
Subsequently, we established PD model rats, and after Gushen Shetuo Decoction gavage treatment, we found
Gushen shetuo decoction, Parkin- that rats in the intervention group had increased mobility (P<0. 05), as well as notably improved pathological
son's disease, clinical efficacy, rat damage of substantia nigra and striatum. Also, the expression of PERK, ATF4 and CHOP in the brain tissues
experiments, symptoms of droo- of rats in the intervention group was lower than those in the control group (P<0. 05). These results confirm
ling
that Gushen Shetuo decoction effectively improved the drooling of patients with PD and showed high safety.
Original paper
Doi: http://dx.doi.org/10.14715/cmb/2023.69.13.27
Copyright: © 2023 by the C.M.B. Association. All rights reserved.
Introduction
wind", "spasm disorder", etc. It is generally agreed upon
that the root of PD is located in the brain and muscles, with
the cause of asthenia in origin and asthenia in superficiality. The asthenia in origin is often attributed to a deficiency
in the liver and kidneys, while the main factors contributing to the asthenia in superficiality are phlegm, blood
stasis, toxins, dampness, and heat. Therefore, the basic
principle for PD treatment is to nourish the kidneys and
strengthen the spleen (8, 9). The Gushen Shetuo decoction
consists of prepared fleece flower root, dried rehamnnia
root, gastrodia tuber and other herbs, which is effective in
nourishing the kidneys, stopping tremors, and strengthening the spleen to deprive the evil wetness (10).
In recent years, our hospital has achieved remarkable
results in the treatment of PD by the Gushen Shetuo decoction, which is now reported as follows, aiming to provide
new references and guidance for future clinical treatment
of PD.
Parkinson's disease (PD) is a common neurodegenerative disease that is more prevalent in the elderly, with an
average onset age of around 60 years (1). In China, the
prevalence of PD in the population aged 65 and older is
approximately 1. 7%, and it increases with age (2). The
majority of PD cases are sporadic, with less than 10% having a family history (3). PD has a gradual and insidious
onset and is characterized by both motor symptoms (e.g.,
resting tremor, bradykinesia, myotonia, and gait disturbance) and non-motor symptoms (e.g., including constipation, dysosmia sleep disorder, and autonomic dysfunction), which greatly affects the normal life and self-care
ability of the patients (4). Currently, there is no cure for
PD, and once diagnosed, patients require lifelong treatment to manage the progression of the disease (5). With
the increasing severity of the global aging problem, the
incidence of PD is also rising, and the diagnosis and treatment of PD have imposed a great economic and healthcare
burden on the patients' families and society (6).
In recent years, with the application of traditional
Chinese medicine (TCM) in treating various types of degenerative chronic diseases, treatment for PD by TCM has
gradually become a hot topic in clinics (7). In the field of
TCM, PD is classified under "trembling disorder", "liver
Materials and Methods
Patient data
Eighty patients with PD were admitted to our hospital
from June 2019 to December 2022. In accordance with the
Good Clinical Practice (GCP) standards, 80 patients were
randomly and double-blindly grouped by randomized
* Corresponding author. Email: 18351891209@163.com; gwfwfg2003@sina.com
Cellular and Molecular Biology, 2023, 69(13): 174-179
174
Peishan Li et al. / Effects of Gushen shetuo decoction on Parkinson's disease, 2023, 69(13): 174-179
numerical table method, with 38 patients in the research
group and 42 patients in the control group. Maintaining
the original Western medicine treatment program of all
patients unchanged, Gushen Shetuo decoction was added
to the research group, and simulants were added to the
control group.
(14) was applied, with the criteria below: 1 = never drools,
dry; 2 = only lips wet; 3 = drool reaches the lips and chin;
4 = drool drips off the chin and onto clothing; 5 = drooling
off the body and onto objects. The grades for frequency
scales were shown below: 1 = never drools; 2 = occasionally drools; 3 = frequently drools; 4 = constantly drools.
Enrollment criteria
Inclusion criteria: 1) Age 30~85 years old, gender is not
limited, diagnostic criteria refer to the United Kingdom
Parkinson's Disease Brain Bank criteria (11); 2) Chinese
medicine diagnostic criteria in line with the All-China
Association of Traditional Chinese Medicine, Geriatrics
Society, 1992 development of the "Chinese medicine
geriatric fibrillation diagnostic and therapeutic evaluation
Criteria; 3) patients with middle to late stage PD between
Hoehn-Yahr grade 2. 5 and 5; 4) PD patients with salivation score of 3 or 4 in question 6 of part II of the Unified
Parkinson's Disease Rating Scale (UPDRS), i. e. , those
with obvious salivation symptoms. Exclusion criteria:
1) secondary Parkinson's syndrome; 2) those with other
severe central nervous system disorders; 3) those with
severe cardiac, pulmonary, or renal disease or multiple
organ failure; 4) those with psychiatric disorders; 5) those
with a history of drug abuse or alcoholism; 6) pregnant
and breastfeeding women; and 7) those who were unable
to cooperate with functional magnetic resonance examination. Removal criteria: 1) those who stopped the trial in the
middle of the trial for non-therapeutic reasons and adverse
reactions; 2) those who added other drugs; 3) those who
could not be counted because of incomplete or obviously
erroneous information.
Animal information
Twenty Sprague Dawley (SD) rats were purchased
from Nanjing Immunophage Biotech Co. , Ltd. , with the
Animal Use License No. of SYXK(SU)2022-0052. The
rats were fed and watered normally for 1 week for acclimatization. This study has been approved by the Animal
Ethics Committee of our hospital.
Treatment method
The formula of the Gushen Shetuo decoction is shown
below: 30 g of prepared fleece flower root, 20 g of dried
rehamnnia root, 20 g of gastrodia tuber, 18 g of hooked
uncaria, 20 g of white peony root, 10 g of bombyx batryticatus, 20 g of lindera aggregata, 20 g of rhizoma dioscoreae, 20 g of bitter cardamon, 10 g of broomrape, and 6 g
of Chinese magnoliavine fruit. Administration and dosage:
The decoction was decocted by an automatic decoction
apparatus, concentrated to 200 mL, and vacuum-packed
in two bags; one bag was administered in the morning and
the other bag in the afternoon every day. Control group
plus placebo (ingredients are starch, dextrin, etc., similar
in appearance, flavor, and texture to Yishen Chuchan Decoction). Patients in both groups were treated continuously for 6 months.
Scoring and investigation
(i) The Movement Disorder Society-sponsored revision
of the Parkinson's Disease Rating Scale (MDS-UPDRS)
(12) was applied, which includes four parts of non-motor experiences of daily living, motor experiences of daily
living, motor examination, and motor complications. The
higher the score, the more severe the symptoms and the
worse the motor function. (ii) The Non-Motor Symptom
Scale (NMSS) (13) was applied, with criteria below: 0 =
none; 1 = symptoms present but causes little distress or
disturbance to patient; 2 = some distress or disturbance to
patient; 3 = major source of distress or disturbance to patient. The higher the score, the more severe the symptoms.
(3) The Drooling Severity and Frequency Scale (DSFS)
Establishment of the PD model
PD model was established with reference to the study
of Guimarães RP et al. (15): The rats were subjected to a
fasting period of 12 hours. After that, they were anesthetized with 2% sodium pentobarbital (via intraperitoneal
injection) and fixed on a brain stereotaxic instrument.
The hair on the top of the rat head was removed, and the
scalp was incised along the midline to expose the skull.
The left striatum of the rats was targeted by a stereotactic
atlas. Then, the rats were injected with 0. 2% 6-hydroxydopamine (6-OHDA), and the needle was left in place for
5 min. Penicillin was applied on the surface to prevent
infection after the wound was sutured. After 3 days, the
rats exhibited gait abnormalities, limb tremors, and slow
movement, indicating successful modeling.
Intervention
The PD rats were randomly divided into an intervention
group and a model group. Rats in the intervention group
received Gushen Shetuo decoction by gavage at 5. 4 g/kg,
and those in the model group received an equal amount of
normal saline by gavage. All the rats were intervened for
21 consecutive days.
Behavior test
After the intervention, behavior tests were performed
(16). Open field test: Rats were placed one by one into an
open field behavioral box measuring 160 × 160 × 50 cm,
with 16 uniformly sized squares (40 × 40 cm) at the bottom of the box. Using a behavioral video analysis system,
the number of squares that the rats crawled over within
5 min was recorded, and the frequency of movement of
rats was calculated (the number of squares crawled over
per minute). Rotation test: After the open-field test, rats
in each group were injected subcutaneously with 0. 5 mg/
kg of apomorphine hydrochloride at the neck. The timing
was started at 5 min after the injection, and the number of
rotations within 30 min was recorded.
HE staining
After the behavior test, all the rats were euthanized under anesthesia by neck dissection, and the substantia nigra
and striatum tissues were isolated, embedded in paraffin,
and sectioned. After deparaffinization with xylene, HE
staining was performed. The slices were rinsed with distilled water, soaked in xylene for transparency, and then
mounted on slides. The pathological manifestations of the
substantia nigra and the striatum tissues in both groups
were examined under a microscope.
175
Peishan Li et al. / Effects of Gushen shetuo decoction on Parkinson's disease, 2023, 69(13): 174-179
Table 1. Primer sequences.
PERK
AFT4
CHOP
β-actin
F (5’-3’)
ACCTAGGCCCTAAATGATCCG
CCAATGGGTAACGGTAACTG
CCGGTACATGTACAATACG
ATTCTGGTACCATGCGTAC
R (5’-3’)
CCTAGTCGGTACCCTAGGCCT
GGTATTCTAAACCTGGGTAC
ATTGAATGACCATGACAGA
TAGTAGCCATGACATGAAC
RT-PCR
In addition, rat striatum tissue was obtained and added
with 1 mL of lysis buffer. The tissue was homogenized in
a tissue homogenizer. Total RNA was extracted following
the instructions provided in the Total RNA Extraction Kit,
and 20 μg of the extracted RNA was reverse transcribed
into cDNA for PCR reaction. The reaction conditions were
as follows: 95℃ for 30 s, 65℃ for 30 s, and 72℃ for 2
min, for a total of 30 cycles. The relative expression of
PERK, ATF4, and CHOP was calculated using the 2-∆∆CT
method with β-actin as the internal reference. The primer
sequences are listed in Table 1.
Statistical analysis
Statistical analysis was performed with the statistical
software SPSS23. 0. Enumeration data were expressed as
[n (%)], with a chi-square test for comparison. Measurement data were expressed as (χ ± s), with an independent
sample t-test for comparison. P<0. 05 was considered statistically significant.
Results
Comparison of MDS-UPDRS scores
According to the results of MDS-UPDRS scores, after
treatment, there was no statistically significant difference
in the scores of NM-EDL, M-EDL, as well as motor functions (P>0. 05); as for motor complications, however, the
scores in the research group were lower than those in the
control group (P<0. 05). Figure 1
tistically significant difference (P>0. 05). Figure 2
Rat modeling
No rats developed peritonitis in this experiment. However, 1 rat in the model group died during gavage, presumably due to asphyxiation caused by the influx of water
into the nasal cavity. All other rats successfully underwent
the modeling and intervention procedures.
Effect of Gushen Shetuo decoction on behaviors of rats
with PD
Behavior tests showed that compared with the model
group, the frequency of movement in the intervention
group was remarkably higher, while the frequency of rotation was remarkably lower (P<0. 05). Figure 4
Effect of Gushen Shetuo decoction on pathological
changes of rats with PD
Subsequently, staining of the rat striatum and substantia nigra revealed a notably reduced number of dopaminergic neurons in the model group, with severe morphological damage and angular appearance. In contrast, rats in
the intervention group showed a higher number of dopaminergic neurons in the striatum, with a relatively intact
structure and clear outline. Figure 5
Comparison of NMSS scores
The NMAA score was (16. 21±3. 71) in the research
group and (16. 62±3. 91) in the control group, with no sta-
Figure 2. Comparison of NMSS scores.
Figure 1. Comparison of MDS-UPDRS scores. a-d) Scores of NMEDL, M-EDL, motor functions and motor complications. motor complications scores were lower in the research group than in the control
group (P<0. 05).
Figure 3. Comparison of DSFS scores. a, b) Scores of severity and
frequency. DSFS scores were lower in the research group than in the
control group (P<0. 05).
176
Peishan Li et al. / Effects of Gushen shetuo decoction on Parkinson's disease, 2023, 69(13): 174-179
Figure 4. Comparison of results of behavioral tests in rats. a, b)
Frequency of movement and rotation. The intervention group had
a higher frequency of movement and a lower frequency of rotation
(P<0. 05).
Figure 5. HE staining of brain substantia nigra and striatal tissue
(40×). the rats in the model group had severe neurological damage in
the brain tissue, while the intervention group was essentially normal.
Effect of Gushen Shetuo decoction on ERK, ATF4, and
CHOP of rats with PD
The expression of PERK, ATF4 and CHOP was measured, which was lower in the striatum of the intervention
group than that of the model group (P<0. 05). Figure 6
Discussion
Judging the symptoms of PD from the perspective
of "disease mechanism and evidence elements" is more
scientific, accurate and easy to grasp than the previous
identification and typing methods. The conclusion that
liver and kidney insufficiency is the pathological basis of
the disease, and wind-phlegm stasis is the center of the disease, also provides a basis for the clinical formulation of
treatment principles. Based on this conclusion, this group
determined that the treatment principle of PD salivation is
to tonify the liver and kidney, and based on this principle
and the method of quenching wind and resolving phlegm
and taking saliva through the collaterals, the Gushen Shetuo Decoction was formulated, and it has achieved satisfactory curative effects in outpatient clinics and inpatient
hospitals.
First of all, in clinical trials, consistent scores of nMEDL, M-EDL, and motor function were observed in the
comparison of MDS-UPDRS scores between the study
and control groups, which suggests that, compared with
the Levodopa and Benserazide Hydrochloride Tablets,
Gushen Shetuo decoction also effectively relieved the
clinical symptoms of PD, guaranteeing a healthy life of
patients. It has been confirmed in the research on TCM
that Gushen decoction can nourish the liver and kidneys
and remove heat to cool blood, which is mainly used for
those who suffer from insufficiency in the liver and kidneys, renal fire, and metrorrhagia and metrostaxis caused
by deficiency of thoroughfare and conception vessel (17).
Therefore, in previous treatment by TCM, the Gushen
decoction was often used for diabetes mellitus, nephropathy, and metrorrhagia (18). As for PD, it is believed that
its clinical symptoms are caused by insufficiency of the
liver and kidneys in TCM. Previous studies have shown
that Fufang Dihuang decoction (prepared Rehmannia root,
white peony root, white peony root, etc. ) and Zishen Pingchan granules (prepared Rehmannia root, white peony
root, jack-in-the-pulpit tuber, etc. ), which are designed to
regulate the functions of the liver and kidney, have significant therapeutic effects on PD (19, 20). On the basis of
the Gushen decoction, prepared fleece flower root, bitter
cardamon, gastrodia tuber, and other herbs were added to
prepare the Gushen Shetuo decoction, which aims to further relieve the neurophysiological symptoms of PD under
the prerequisite of improving the dyskinesia caused by
deficiency of kidney-essence in patients with PD. PD is a
neurological disorder; patients with PD cannot control the
function of various parts of the body, so drooling is also
a typical clinical manifestation (21). For drooling, bitter
cardamon, white peony root and other herbs were added
to warm up the spleen and stomach, and control the saliva
to stop drooling (22). Therefore, the scores in severity and
frequency of the research group were lower than those of
the control group in the DSFS score comparison. We believe that the Prepared He Shou Wu in Gushen Shetuo Decoction tonifies the liver and kidney and benefits essence
and blood, directly targeting the pathological basis of liver
and kidney insufficiency in salivation in PD for improvement. Adjuncts Radix Rehmanniae Praeparata and Radix
Paeoniae Alba nourish yin and astringent the liver, Tianma
and Crocus sativus calm the liver and quench wind to clear
the channels, Stiffworms dispel wind and resolve phlegm,
Yizhi Ren and Chinese yam consolidate the kidneys and
regulate salivation, and Cistanches tonify the kidney yang
and benefit essence and blood. In addition, Schisandra
chinensis is warm and acidic in nature, which can take in
the saliva, and Gushen Shetuo Decoction can nourish the
liver and kidney, quench the wind and resolve phlegm, and
take in the saliva through the all-around Yin and Yang tonic, and take into account both the real and the imaginary,
and treat the symptom and the root of the disease. The use
of the Gushen Shetuo decoction not only nourished yin,
kidneys and qi, promoted blood flow, but also effectively
alleviated neurological dysfunction, and improved nerve
perception and regulation ability. Besides, lindera aggregata, rhizoma dioscoreae, and white peony root are yin
herbs, which are effective in removing heat in the liver and
improving liver and kidney functions (23). Lower motor
177
Figure 6. Comparison of ERK, ATF4, and CHOP expression levels.
a-c) ERK, ATF4, and CHOP mRNA. ERK, ATF4, and CHOP mRNA
were lower in the intervention group than in the model group.
Peishan Li et al. / Effects of Gushen shetuo decoction on Parkinson's disease, 2023, 69(13): 174-179
complication scores observed in the research group proved
that the Gushen Shetuo decoction has a higher safety in the
treatment of PD. Such a result is conceivable, as the safety
of Chinese herbal formula has been verified many times in
previous studies (24, 25).
To further confirm the ameliorative effect of the
Gushen Shetuo decoction on PD, we observed the mechanism of action of the decoction by establishing a rat model
of PD through oral gavage with the decoction. According
to the results of the behavior tests, rats in the intervention group showed an increased frequency of movement
but decreased frequency of rotation, suggesting that the
Gushen Shetuo decoction effectively restored behavior
disorders in PD rats. It is well-known that fleece flower
root contains a large amount of stilbene glycosides, and
studies have shown that stilbene glycosides can increase
dopamine content in the nigrostriatal system and have a
protective effect on dopaminergic neurons (26). In the
HE staining of the substantia nigra and striatum of rats
in the two groups, it was observed that the neurons in the
intervention group were well-preserved and their numbers
increased. Such strongly indicates the neuroprotective
and regenerative effects of the Gushen Shetuo decoction
on PD rats. Moreover, the expression of PERK, ATF4 and
CHOP in the brain tissues of rats in the research group was
significantly lower than those in the control group, which
also indicated that the Gushen Shetuo decoction alleviated
the endoplasmic reticulum stress in the brain tissues of PD
rats. As transmembrane protein kinases in the endoplasmic
reticulum, PERK, ATF4 and CHOP directly mediate the
process of endoplasmic reticulum stress (27). We hypothesized that certain saponins and flavonoids contained in the
Gushen Shetuo decoction scavenged excess oxygen free
radicals in the body, inhibited the reduction of dopaminergic neurons in rat brains, and promoted the anti-oxidative
stress effect (28). Therefore, the endoplasmic reticulum
stress in PD was greatly relieved.
However, due to the limited experimental conditions,
more in vitro experiments are still needed to confirm the
mechanism of the Gushen Shetuo decoction on PD, and
more clinical trials should be conducted to further verify
its effect in improving PD.
The Gushen Shetuo decoction is effective in the treatment of PD, which improves the drooling symptoms of
patients and has high safety. Its mechanism may be related
to the relief of endoplasmic reticulum stress and the repair
of the damage to the striatum and substantia nigra in PD.
In the future, the Gushen Shetuo decoction can be used
as a clinical treatment option for PD, providing a reliable
guarantee for the improvement of patients' conditions.
Ethical approval
The study protocol was approved by the Ethics Committee of The Affiliated Brain Hospital of Nanjing Medical
University(NO: 2019-KY137-01).
Conflicts of interest
The authors report no conflict of interest.
Availability of data and materials
The data that support the findings of this study are available
from the corresponding author upon reasonable request.
Funding
This work was supported by The Jiangsu Provincial Ad-
ministration of Traditional Chinese Medicine Science and
Technology Development Key Projects(NO. 2020ZX17);
Nanjing Medical Science and Technology Development
Program(NO. YKK20094); Nanjing Chinese Medicine
Science and Technology Program(NO. ZYYB202206)
and Nanjing Medical University Foundation(NO.
NMUB20210234).
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
178
Tolosa E, Garrido A, Scholz SW, Poewe W. Challenges in the diagnosis of Parkinson's disease. Lancet Neurol 2021;20(5):385-97.
doi: 10. 1016/S1474-4422(21)00030-2.
Cabreira V, Massano J. Parkinson's Disease: Clinical Review and
Update. Acta Med Port 2019;32(10):661-70. doi: 10. 20344/amp.
11978.
Elsworth JD. Parkinson's disease treatment: past, present, and
future. J Neural Transm (Vienna) 2020;127(5):785-91. doi: 10.
1007/s00702-020-02167-1.
Reich SG, Savitt JM. Parkinson's Disease. Med Clin North Am
2019;103(2):337-50. doi: 10. 1016/j. mcna. 2018. 10. 014.
Cerri S, Mus L, Blandini F. Parkinson's Disease in Women and
Men: What's the Difference? J Parkinsons Dis 2019;9(3):501-15.
doi: 10. 3233/JPD-191683.
Jankovic J, Tan EK. Parkinson's disease: etiopathogenesis and
treatment. J Neurol Neurosurg Psychiatry 2020;91(8):795-808.
doi: 10. 1136/jnnp-2019-322338.
Muhammad F, Liu Y, Zhou Y, Yang H, Li H. Antioxidative role
of Traditional Chinese Medicine in Parkinson's disease. J Ethnopharmacol 2022;285:114821. doi: 10. 1016/j. jep. 2021. 114821.
Liu YY, Yu LH, Zhang J, Xie DJ, Zhang XX, Yu JM. Network
Pharmacology-Based and Molecular Docking-Based Analysis of
Suanzaoren Decoction for the Treatment of Parkinson's Disease
with Sleep Disorder. Biomed Res Int 2021;2021:1752570. doi:
10. 1155/2021/1752570.
Chen J, Xu J, Huang P, Luo Y, Shi Y, Ma P. The potential applications of traditional Chinese medicine in Parkinson's disease: A
new opportunity. Biomed Pharmacother 2022;149:112866. doi:
10. 1016/j. biopha. 2022. 112866.
Li SK, Fan YX, Cao XW, Zhao J, Zhu S, Liu ZQ. Effect of administration of acupuncture stimulation combined with Gushen
Zhuyu Decoction on lumbar function in patients with disc herniation. Zhen Ci Yan Jiu 2022;47(10):907-13. doi: 10. 13702/j.
1000-0607. 20210951.
Chia SJ, Tan EK, Chao YX. Historical Perspective: Models of
Parkinson's Disease. Int J Mol Sci 2020;21(7). doi: 10. 3390/
ijms21072464.
Goetz CG, Tilley BC, Shaftman SR, Stebbins GT, Fahn S, Martinez-Martin P, et al. Movement Disorder Society-sponsored
revision of the Unified Parkinson's Disease Rating Scale (MDSUPDRS): scale presentation and clinimetric testing results. Mov
Disord 2008;23(15):2129-70. doi: 10. 1002/mds. 22340.
Schaible F, Maier F, Buchwitz TM, Schwartz F, Hoock M,
Schonau E, et al. Effects of Lee Silverman Voice Treatment
BIG and conventional physiotherapy on non-motor and motor
symptoms in Parkinson's disease: a randomized controlled study comparing three exercise models. Ther Adv Neurol Disord
2021;14:1756286420986744. doi: 10. 1177/1756286420986744.
Rashnoo P, Daniel SJ. Drooling quantification: Correlation of different techniques. Int J Pediatr Otorhinolaryngol 2015;79(8):12015. doi: 10. 1016/j. ijporl. 2015. 05. 010.
Guimaraes RP, Ribeiro DL, Dos Santos KB, Godoy LD, Correa
MR, Padovan-Neto FE. The 6-hydroxydopamine Rat Model of
Parkinson's Disease. J Vis Exp 2021(176). doi: 10. 3791/62923.
Peishan Li et al. / Effects of Gushen shetuo decoction on Parkinson's disease, 2023, 69(13): 174-179
16. Miyanishi K, Choudhury ME, Watanabe M, Kubo M, Nomoto
M, Yano H, et al. Behavioral tests predicting striatal dopamine
level in a rat hemi-Parkinson's disease model. Neurochem Int
2019;122:38-46. doi: 10. 1016/j. neuint. 2018. 11. 005.
17. Chen P, Zhang J, Wang C, Chai YH, Wu AG, Huang NY, et al. The
pathogenesis and treatment mechanism of Parkinson's disease
from the perspective of traditional Chinese medicine. Phytomedicine 2022;100:154044. doi: 10. 1016/j. phymed. 2022. 154044.
18. Zhou X, Liu Z, Zhou X, Xiang Y, Zhou Z, Zhao Y, et al. The
Chinese Parkinson's Disease Registry (CPDR): Study Design and
Baseline Patient Characteristics. Mov Disord 2022;37(7):133545. doi: 10. 1002/mds. 29037.
19. Khan AU, Akram M, Daniyal M, Zainab R. Awareness and current knowledge of Parkinson's disease: a neurodegenerative disorder. Int J Neurosci 2019;129(1):55-93. doi: 10. 1080/00207454.
2018. 1486837.
20. Zhang L, Yang Z, Zhao Y, Yang X, Meng X, Liu J, et al. Renoprotective effects of Gushen Jiedu capsule on diabetic nephropathy in
rats. Sci Rep 2020;10(1):2040. doi: 10. 1038/s41598-020-587812.
21. Feng ST, Wang XL, Wang YT, Yuan YH, Li ZP, Chen NH, et al.
Efficacy of Traditional Chinese Medicine Combined with Selective Serotonin Reuptake Inhibitors on the Treatment for Parkinson's Disease with Depression: A Systematic Review and MetaAnalysis. Am J Chin Med 2021;49(3):627-43. doi: 10. 1142/
S0192415X21500282.
22. Tian CM, Chen B. Effects of Gushen Antai pills combined with
23.
24.
25.
26.
27.
28.
179
progestin on serum beta-HCG, P, E2 and CA125 in patients with
threatened abortion. Zhongguo Zhong Yao Za Zhi 2016;41(2):3215. doi: 10. 4268/cjcmm20160225.
Ma YJ, Cao XL, Ma T, Song JY, Yu LY, Yu YY, et al. Study protocol: a multi-center, double-blind, randomized, 6-month, placebocontrolled trial to investigate the effect of supplementing hormone
therapy FET cycles with Gushen'antai pills on the outcomes of in
vitro fertilization. Trials 2021;22(1):657. doi: 10. 1186/s13063021-05614-w.
Gao Y, Li J, Wu Q, Wang S, Yang S, Li X, et al. Tetrahydroxy stilbene glycoside ameliorates Alzheimer's disease in APP/PS1 mice
via glutathione peroxidase related ferroptosis. Int Immunopharmacol 2021;99:108002. doi: 10. 1016/j. intimp. 2021. 108002.
Han X, Zhao S, Song H, Xu T, Fang Q, Hu G, et al. Kaempferol
alleviates LD-mitochondrial damage by promoting autophagy:
Implications in Parkinson's disease. Redox Biol 2021;41:101911.
doi: 10. 1016/j. redox. 2021. 101911.
Krawczyk H. The stilbene derivatives, nucleosides, and nucleosides modified by stilbene derivatives. Bioorg Chem
2019;90:103073. doi: 10. 1016/j. bioorg. 2019. 103073.
Singh C, Ahmad I, Kumar A. Pesticides and metals induced Parkinson's disease: involvement of free radicals and oxidative stress.
Cell Mol Biol (Noisy-le-grand) 2007;53(5):19-28.
Wang X, Ma Y, Xu Q, Shikov AN, Pozharitskaya ON, Flisyuk
EV, et al. Flavonoids and saponins: What have we got or missed?
Phytomedicine 2023;109:154580. doi: 10. 1016/j. phymed. 2022.
154580.